Incidental Mutation 'R1077:Wdr33'
ID85707
Institutional Source Beutler Lab
Gene Symbol Wdr33
Ensembl Gene ENSMUSG00000024400
Gene NameWD repeat domain 33
Synonyms2810021O11Rik, 1110001N06Rik, 8430413N20Rik, 2310011G05Rik, WDC146
MMRRC Submission 039163-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.954) question?
Stock #R1077 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location31804057-31908987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31835461 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 235 (H235R)
Ref Sequence ENSEMBL: ENSMUSP00000025264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025264] [ENSMUST00000082319]
Predicted Effect probably benign
Transcript: ENSMUST00000025264
AA Change: H235R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025264
Gene: ENSMUSG00000024400
AA Change: H235R

DomainStartEndE-ValueType
WD40 107 147 2.15e-1 SMART
WD40 150 189 5.77e-5 SMART
WD40 191 230 1.89e-9 SMART
WD40 233 274 2.59e-7 SMART
WD40 277 316 2.73e-6 SMART
WD40 320 360 1.71e-7 SMART
WD40 364 403 1.52e-4 SMART
low complexity region 481 499 N/A INTRINSIC
coiled coil region 531 559 N/A INTRINSIC
low complexity region 573 587 N/A INTRINSIC
low complexity region 608 624 N/A INTRINSIC
low complexity region 628 668 N/A INTRINSIC
low complexity region 679 722 N/A INTRINSIC
low complexity region 725 761 N/A INTRINSIC
internal_repeat_1 778 803 3.47e-9 PROSPERO
low complexity region 806 818 N/A INTRINSIC
internal_repeat_1 821 845 3.47e-9 PROSPERO
low complexity region 848 881 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 938 951 N/A INTRINSIC
low complexity region 1000 1018 N/A INTRINSIC
low complexity region 1041 1049 N/A INTRINSIC
low complexity region 1057 1100 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1190 1207 N/A INTRINSIC
low complexity region 1251 1262 N/A INTRINSIC
low complexity region 1287 1330 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000082319
AA Change: H235R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000080936
Gene: ENSMUSG00000024400
AA Change: H235R

DomainStartEndE-ValueType
WD40 107 147 2.15e-1 SMART
WD40 150 189 5.77e-5 SMART
WD40 191 230 1.89e-9 SMART
Meta Mutation Damage Score 0.0784 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is highly expressed in testis and the protein is localized to the nucleus. This gene may play important roles in the mechanisms of cytodifferentiation and/or DNA recombination. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Cdc25c A T 18: 34,748,973 probably benign Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Other mutations in Wdr33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr33 APN 18 31878116 missense probably damaging 1.00
IGL01099:Wdr33 APN 18 31906789 unclassified probably benign
IGL01628:Wdr33 APN 18 31888310 missense unknown
IGL03296:Wdr33 APN 18 31827391 missense probably benign 0.03
R0103:Wdr33 UTSW 18 31833335 missense probably damaging 1.00
R0279:Wdr33 UTSW 18 31888324 missense unknown
R0563:Wdr33 UTSW 18 31886739 missense possibly damaging 0.94
R0730:Wdr33 UTSW 18 31835376 splice site probably benign
R1377:Wdr33 UTSW 18 31888641 missense unknown
R1712:Wdr33 UTSW 18 31896631 missense unknown
R1855:Wdr33 UTSW 18 31906856 unclassified probably benign
R2013:Wdr33 UTSW 18 31888976 missense unknown
R2014:Wdr33 UTSW 18 31833599 missense probably damaging 1.00
R4497:Wdr33 UTSW 18 31893079 missense unknown
R4727:Wdr33 UTSW 18 31888447 missense unknown
R4739:Wdr33 UTSW 18 31886086 missense probably benign 0.17
R4777:Wdr33 UTSW 18 31881248 missense probably damaging 1.00
R4907:Wdr33 UTSW 18 31906993 makesense probably null
R5811:Wdr33 UTSW 18 31902620 missense unknown
R6053:Wdr33 UTSW 18 31878063 missense possibly damaging 0.93
R6454:Wdr33 UTSW 18 31829975 missense possibly damaging 0.47
R7112:Wdr33 UTSW 18 31893003 missense unknown
R7369:Wdr33 UTSW 18 31886666 missense probably benign 0.00
R7519:Wdr33 UTSW 18 31896770 missense unknown
RF014:Wdr33 UTSW 18 31881273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCACTGTTAAGGCAACTCCCCG -3'
(R):5'- AGGCTGCCATGACTATGTGAGCTG -3'

Sequencing Primer
(F):5'- GCAGCATTAGGACTAGTAATGTACC -3'
(R):5'- GTATTTTCCTAAAGGGCACAGG -3'
Posted On2013-11-18