Incidental Mutation 'R1077:Cdc25c'
ID85708
Institutional Source Beutler Lab
Gene Symbol Cdc25c
Ensembl Gene ENSMUSG00000044201
Gene Namecell division cycle 25C
SynonymsCdc25
MMRRC Submission 039163-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1077 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34732997-34751533 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 34748973 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060710]
Predicted Effect probably benign
Transcript: ENSMUST00000060710
SMART Domains Protein: ENSMUSP00000055427
Gene: ENSMUSG00000044201

DomainStartEndE-ValueType
low complexity region 246 257 N/A INTRINSIC
RHOD 284 398 3.71e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181641
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: This gene encodes a dual specificity phosphatase that dephosphorylates cyclin B-bound Cdk1 to trigger entry into mitosis. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal T and B lymphocyte development and proliferative responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921528I07Rik T C 9: 114,301,702 noncoding transcript Het
Apob A G 12: 8,006,017 K1500E probably benign Het
Atp8b1 A T 18: 64,573,262 Y225* probably null Het
Ceacam15 T C 7: 16,672,075 N184D probably benign Het
Cntln T C 4: 84,996,479 S508P probably damaging Het
Dhx34 A G 7: 16,218,368 S111P probably damaging Het
Dst A G 1: 34,164,167 E759G probably damaging Het
Fis1 G A 5: 136,965,146 A28T probably damaging Het
Fsd1 T C 17: 55,990,542 probably null Het
Gm15293 T A 8: 21,202,433 F90Y probably benign Het
Grk6 T C 13: 55,454,527 probably null Het
Il23r A T 6: 67,473,810 H228Q probably benign Het
Kcnh4 C T 11: 100,752,338 V368I possibly damaging Het
Kdr T C 5: 75,956,231 E728G probably damaging Het
Krt33a T A 11: 100,015,937 M71L probably benign Het
Lrrc7 T G 3: 158,161,143 D987A probably damaging Het
Naalad2 C T 9: 18,347,506 R491Q probably damaging Het
Nedd4l A T 18: 65,167,499 probably benign Het
Pramel7 A G 2: 87,491,190 L167S probably damaging Het
Prkci A G 3: 31,050,192 D568G probably damaging Het
Psg18 G A 7: 18,351,075 T32I possibly damaging Het
Ric8b T A 10: 84,970,717 probably benign Het
Rnf213 T C 11: 119,485,998 probably benign Het
Rttn T C 18: 89,064,249 V1433A probably damaging Het
Sbf2 A T 7: 110,367,172 probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sfta2 T C 17: 35,650,127 probably benign Het
Slc17a1 T A 13: 23,878,450 probably benign Het
Slc6a21 G A 7: 45,288,202 C314Y probably benign Het
Smpd4 T C 16: 17,623,969 V35A probably damaging Het
Sorl1 T C 9: 42,014,490 D1182G probably damaging Het
Syne2 A G 12: 76,042,035 I5056V possibly damaging Het
Tex14 T C 11: 87,519,745 probably benign Het
Tex44 A G 1: 86,427,055 T229A probably benign Het
Tfap2b T A 1: 19,234,149 C394* probably null Het
Ttk T A 9: 83,844,149 probably benign Het
Vmn2r26 G A 6: 124,053,913 V536I probably benign Het
Wac A G 18: 7,921,916 T553A probably damaging Het
Wdcp T A 12: 4,850,685 H180Q probably damaging Het
Wdr33 A G 18: 31,835,461 H235R probably benign Het
Other mutations in Cdc25c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Cdc25c APN 18 34747241 missense probably benign 0.45
IGL01357:Cdc25c APN 18 34734857 splice site probably null
IGL02122:Cdc25c APN 18 34743985 missense probably benign 0.03
R0053:Cdc25c UTSW 18 34735435 missense probably benign 0.16
R0053:Cdc25c UTSW 18 34735435 missense probably benign 0.16
R1679:Cdc25c UTSW 18 34747295 missense probably damaging 1.00
R2036:Cdc25c UTSW 18 34738239 missense probably damaging 1.00
R2051:Cdc25c UTSW 18 34738239 missense probably damaging 1.00
R2077:Cdc25c UTSW 18 34738239 missense probably damaging 1.00
R2511:Cdc25c UTSW 18 34738239 missense probably damaging 1.00
R5304:Cdc25c UTSW 18 34750811 missense possibly damaging 0.71
R5604:Cdc25c UTSW 18 34733648 missense probably damaging 1.00
R7833:Cdc25c UTSW 18 34747243 missense probably benign 0.17
R7916:Cdc25c UTSW 18 34747243 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACTTGAGCGTGTACAGAGTCTACATAGG -3'
(R):5'- GCCTTGACCTTTCGAATCTTAGCAGTG -3'

Sequencing Primer
(F):5'- GATAACATCCCTGTGATTCATACAGC -3'
(R):5'- cctcagaagccagaagaagaac -3'
Posted On2013-11-18