Mutagenetix > Incidental Mutation

Incidental Mutation 'R1078:Igfn1'

85714

Institutional Source

Beutler Lab

Gene Symbol

Igfn1

Ensembl Gene

ENSMUSG00000051985

Gene Name

immunoglobulin-like and fibronectin type III domain containing 1

Synonyms

9830123M21Rik

MMRRC Submission

039164-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.086) question?

Stock #

R1078 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

135953578-136006342 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135974847 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 371 (Y371H)

Ref Sequence

ENSEMBL: ENSMUSP00000129680 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166193]

AlphaFold

no structure available at present

Predicted Effect

unknown
Transcript: ENSMUST00000124134
AA Change: Y250H

SMART Domains

Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985
AA Change: Y250H

Domain	Start	End	E-Value	Type
IG	73	159	1.29e-6	SMART
IG_like	258	344	5.45e1	SMART
IG	354	435	1.79e0	SMART
IG	445	524	3.54e-4	SMART
IG	538	624	4.86e-2	SMART
FN3	627	711	3.99e-10	SMART
FN3	727	810	9.1e-14	SMART
FN3	828	911	1.5e-14	SMART
IG	938	1021	6.41e-2	SMART
FN3	1024	1106	3.2e-9	SMART
IGc2	1152	1219	4.89e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000166193
AA Change: Y371H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: Y371H

Domain	Start	End	E-Value	Type
low complexity region	90	101	N/A	INTRINSIC
IG	193	279	1.29e-6	SMART
PDB:2LHU\|A	302	365	8e-7	PDB
IG_like	378	464	5.45e1	SMART
IG	474	555	1.79e0	SMART
low complexity region	724	739	N/A	INTRINSIC
internal_repeat_2	838	1006	9.98e-5	PROSPERO
low complexity region	1067	1084	N/A	INTRINSIC
internal_repeat_2	1812	1967	9.98e-5	PROSPERO
Pfam:I-set	2054	2139	6.2e-8	PFAM
IG	2153	2239	4.86e-2	SMART
FN3	2242	2326	3.99e-10	SMART
FN3	2342	2425	9.1e-14	SMART
FN3	2443	2526	1.5e-14	SMART
IG	2553	2636	6.41e-2	SMART
FN3	2639	2721	3.2e-9	SMART
IGc2	2767	2834	4.89e-7	SMART

Meta Mutation Damage Score

0.2641

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.4%
20x: 94.4%

Validation Efficiency

96% (53/55)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,611,762	I358S	probably benign	Het
9130230L23Rik	T	C	5: 65,988,355	T138A	unknown	Het
Abi3bp	T	C	16: 56,654,081		probably null	Het
Alpk3	A	T	7: 81,078,600	M493L	probably benign	Het
Bace2	C	T	16: 97,356,860	A20V	unknown	Het
Bms1	T	C	6: 118,405,221	D452G	probably benign	Het
Ccdc187	T	C	2: 26,294,377	T3A	probably damaging	Het
Ctu2	T	C	8: 122,481,499	V95A	possibly damaging	Het
Cyp2a5	A	G	7: 26,835,541	K60E	probably benign	Het
Cyp4f13	T	C	17: 32,925,568	H318R	probably damaging	Het
Dlgap5	G	A	14: 47,399,566	T485M	probably damaging	Het
Dsp	C	T	13: 38,183,106		probably benign	Het
Ell2	T	C	13: 75,746,419		probably benign	Het
Eml2	A	T	7: 19,179,762	Y168F	probably benign	Het
Ep400	C	T	5: 110,735,522		probably benign	Het
Ercc4	C	A	16: 13,130,197	A336D	probably benign	Het
Fam189a2	T	A	19: 23,973,575	R547S	probably benign	Het
Fat4	T	C	3: 38,983,086	L3629S	probably benign	Het
Gabbr2	C	T	4: 46,664,833	R925H	probably damaging	Het
Gfi1b	A	T	2: 28,613,865	W108R	probably damaging	Het
Gtse1	C	T	15: 85,862,307	P108L	probably damaging	Het
Hfm1	A	T	5: 106,878,830	F140I	probably damaging	Het
Hyal2	T	A	9: 107,572,246	H400Q	probably benign	Het
Iltifb	T	G	10: 118,290,151	*180C	probably null	Het
Kdm2b	T	C	5: 122,961,541	T118A	possibly damaging	Het
Lama5	A	T	2: 180,179,764		probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lmo7	C	T	14: 101,920,474		probably benign	Het
Lrrc37a	G	T	11: 103,497,631	P2323T	unknown	Het
Lrrc38	A	G	4: 143,350,518	Y117C	probably benign	Het
Myo1e	T	C	9: 70,383,999	V1024A	probably benign	Het
Myrfl	T	C	10: 116,776,732	N904S	possibly damaging	Het
Olfr1015	T	C	2: 85,786,093	V194A	possibly damaging	Het
Olfr103	T	A	17: 37,337,026	I69F	probably damaging	Het
Olfr1297	T	C	2: 111,621,345	H243R	probably damaging	Het
Pld4	A	T	12: 112,763,442	I53F	probably benign	Het
Plekhg4	T	A	8: 105,381,677	C1117*	probably null	Het
Prss39	G	A	1: 34,502,086	E224K	probably benign	Het
Psme1	G	T	14: 55,580,650	G149V	probably damaging	Het
Soat2	T	A	15: 102,153,138		probably null	Het
Stab2	C	T	10: 86,907,133		probably null	Het
Tcf7l2	A	G	19: 55,743,195	T127A	probably benign	Het
Tcp1	T	C	17: 12,923,204		probably benign	Het
Thbs4	G	A	13: 92,762,926		probably benign	Het
Tmf1	T	C	6: 97,173,300	D482G	probably damaging	Het
Trim66	G	T	7: 109,472,319	P591H	probably damaging	Het
Umodl1	T	C	17: 30,959,373	S108P	probably benign	Het
Unc79	T	G	12: 103,074,853	M715R	probably benign	Het
Usp34	C	A	11: 23,433,175		probably benign	Het
Utrn	T	G	10: 12,455,566		probably null	Het
Zfp830	T	C	11: 82,765,339		probably null	Het

Other mutations in Igfn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00753:Igfn1	APN	1	135966726	missense	probably damaging	1.00
IGL02299:Igfn1	APN	1	135954017	utr 3 prime	probably benign
Bounty	UTSW	1	135976917	critical splice donor site	probably null
R2276_Igfn1_773	UTSW	1	135964741	missense	probably damaging	0.98
R4058_Igfn1_315	UTSW	1	135969756	missense	probably benign	0.07
R0144:Igfn1	UTSW	1	135962013	missense	probably damaging	0.99
R0190:Igfn1	UTSW	1	135962052	missense	probably damaging	1.00
R0350:Igfn1	UTSW	1	135956767	nonsense	probably null
R0413:Igfn1	UTSW	1	135967596	missense	probably benign	0.23
R0504:Igfn1	UTSW	1	135968529	missense	probably benign	0.00
R0606:Igfn1	UTSW	1	135959901	missense	probably damaging	1.00
R0681:Igfn1	UTSW	1	135963853	missense	possibly damaging	0.88
R0825:Igfn1	UTSW	1	135963126	missense	probably damaging	1.00
R0839:Igfn1	UTSW	1	135954680	missense	probably damaging	1.00
R1066:Igfn1	UTSW	1	135970725	missense	probably benign
R1224:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R1569:Igfn1	UTSW	1	135969033	missense	probably benign
R1626:Igfn1	UTSW	1	135968967	missense	probably benign	0.29
R1663:Igfn1	UTSW	1	135968308	missense	probably benign	0.15
R1677:Igfn1	UTSW	1	135971101	missense	probably damaging	0.99
R1709:Igfn1	UTSW	1	135955573	missense	probably benign	0.24
R1728:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1728:Igfn1	UTSW	1	135968199	missense	probably benign
R1728:Igfn1	UTSW	1	135970411	missense	probably benign
R1728:Igfn1	UTSW	1	135972127	missense	probably benign
R1728:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1728:Igfn1	UTSW	1	135982475	missense	probably benign
R1728:Igfn1	UTSW	1	135998625	missense	probably benign
R1728:Igfn1	UTSW	1	135998683	missense	unknown
R1729:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1729:Igfn1	UTSW	1	135968199	missense	probably benign
R1729:Igfn1	UTSW	1	135970411	missense	probably benign
R1729:Igfn1	UTSW	1	135972127	missense	probably benign
R1729:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1729:Igfn1	UTSW	1	135982475	missense	probably benign
R1729:Igfn1	UTSW	1	135998625	missense	probably benign
R1729:Igfn1	UTSW	1	135998683	missense	unknown
R1730:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1730:Igfn1	UTSW	1	135968199	missense	probably benign
R1730:Igfn1	UTSW	1	135970411	missense	probably benign
R1730:Igfn1	UTSW	1	135972127	missense	probably benign
R1730:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1730:Igfn1	UTSW	1	135982475	missense	probably benign
R1730:Igfn1	UTSW	1	135998625	missense	probably benign
R1730:Igfn1	UTSW	1	135998683	missense	unknown
R1739:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1739:Igfn1	UTSW	1	135968199	missense	probably benign
R1739:Igfn1	UTSW	1	135970411	missense	probably benign
R1739:Igfn1	UTSW	1	135972127	missense	probably benign
R1739:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1739:Igfn1	UTSW	1	135982475	missense	probably benign
R1739:Igfn1	UTSW	1	135998625	missense	probably benign
R1739:Igfn1	UTSW	1	135998683	missense	unknown
R1746:Igfn1	UTSW	1	135969823	missense	possibly damaging	0.88
R1762:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1762:Igfn1	UTSW	1	135968199	missense	probably benign
R1762:Igfn1	UTSW	1	135970411	missense	probably benign
R1762:Igfn1	UTSW	1	135972127	missense	probably benign
R1762:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1762:Igfn1	UTSW	1	135982475	missense	probably benign
R1762:Igfn1	UTSW	1	135998625	missense	probably benign
R1762:Igfn1	UTSW	1	135998683	missense	unknown
R1783:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1783:Igfn1	UTSW	1	135968199	missense	probably benign
R1783:Igfn1	UTSW	1	135970411	missense	probably benign
R1783:Igfn1	UTSW	1	135972127	missense	probably benign
R1783:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1783:Igfn1	UTSW	1	135982475	missense	probably benign
R1783:Igfn1	UTSW	1	135998625	missense	probably benign
R1783:Igfn1	UTSW	1	135998683	missense	unknown
R1784:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1784:Igfn1	UTSW	1	135968199	missense	probably benign
R1784:Igfn1	UTSW	1	135970411	missense	probably benign
R1784:Igfn1	UTSW	1	135972127	missense	probably benign
R1784:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1784:Igfn1	UTSW	1	135982475	missense	probably benign
R1784:Igfn1	UTSW	1	135998625	missense	probably benign
R1784:Igfn1	UTSW	1	135998683	missense	unknown
R1785:Igfn1	UTSW	1	135959928	missense	probably damaging	1.00
R1785:Igfn1	UTSW	1	135968199	missense	probably benign
R1785:Igfn1	UTSW	1	135970411	missense	probably benign
R1785:Igfn1	UTSW	1	135972127	missense	probably benign
R1785:Igfn1	UTSW	1	135979915	missense	probably benign	0.00
R1785:Igfn1	UTSW	1	135982475	missense	probably benign
R1785:Igfn1	UTSW	1	135998625	missense	probably benign
R1785:Igfn1	UTSW	1	135998683	missense	unknown
R1847:Igfn1	UTSW	1	135969388	missense	probably benign
R1866:Igfn1	UTSW	1	135974868	splice site	probably null
R1921:Igfn1	UTSW	1	135966063	critical splice donor site	probably null
R1984:Igfn1	UTSW	1	135962044	missense	probably benign	0.39
R2049:Igfn1	UTSW	1	135970638	missense	probably benign
R2049:Igfn1	UTSW	1	135974852	splice site	probably benign
R2098:Igfn1	UTSW	1	135978305	missense	probably damaging	1.00
R2130:Igfn1	UTSW	1	135974852	splice site	probably benign
R2141:Igfn1	UTSW	1	135974852	splice site	probably benign
R2276:Igfn1	UTSW	1	135964741	missense	probably damaging	0.98
R2425:Igfn1	UTSW	1	135963102	missense	probably damaging	1.00
R2483:Igfn1	UTSW	1	135969537	missense	probably benign
R2504:Igfn1	UTSW	1	135969316	missense	probably benign	0.07
R3109:Igfn1	UTSW	1	135997848	missense	probably benign	0.12
R3421:Igfn1	UTSW	1	135976917	critical splice donor site	probably null
R3423:Igfn1	UTSW	1	135998641	missense	probably benign	0.01
R3705:Igfn1	UTSW	1	135968409	missense	probably benign
R3871:Igfn1	UTSW	1	135968836	missense	probably benign	0.03
R3875:Igfn1	UTSW	1	135954614	missense	probably damaging	1.00
R3953:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3955:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3957:Igfn1	UTSW	1	135967180	missense	possibly damaging	0.61
R3965:Igfn1	UTSW	1	135967819	missense	probably benign
R4006:Igfn1	UTSW	1	135982362	splice site	probably null
R4058:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R4059:Igfn1	UTSW	1	135969756	missense	probably benign	0.07
R4370:Igfn1	UTSW	1	135968106	missense	probably benign	0.00
R4380:Igfn1	UTSW	1	135967771	missense	probably benign	0.00
R4495:Igfn1	UTSW	1	135969678	missense	possibly damaging	0.79
R4628:Igfn1	UTSW	1	135959730	missense	possibly damaging	0.47
R4672:Igfn1	UTSW	1	135965369	missense	possibly damaging	0.72
R4682:Igfn1	UTSW	1	135998625	missense	probably benign
R4702:Igfn1	UTSW	1	135967209	missense	possibly damaging	0.71
R4744:Igfn1	UTSW	1	135982458	missense	probably benign	0.07
R4777:Igfn1	UTSW	1	135954862	missense	probably benign
R4806:Igfn1	UTSW	1	135967357	missense	probably benign	0.01
R4840:Igfn1	UTSW	1	135968040	missense	probably benign	0.00
R4894:Igfn1	UTSW	1	135954782	missense	probably damaging	1.00
R4998:Igfn1	UTSW	1	135954666	missense	probably damaging	1.00
R5092:Igfn1	UTSW	1	135964826	missense	probably benign
R5108:Igfn1	UTSW	1	135982441	missense	probably benign
R5120:Igfn1	UTSW	1	135973502	missense	possibly damaging	0.93
R5127:Igfn1	UTSW	1	135959896	missense	probably damaging	1.00
R5231:Igfn1	UTSW	1	135966736	missense	probably benign	0.26
R5286:Igfn1	UTSW	1	135967861	missense	probably benign	0.10
R5307:Igfn1	UTSW	1	135964938	missense	probably damaging	1.00
R5380:Igfn1	UTSW	1	135966087	missense	probably damaging	1.00
R5553:Igfn1	UTSW	1	135967884	missense	probably damaging	1.00
R5660:Igfn1	UTSW	1	135970414	missense	probably benign	0.01
R5779:Igfn1	UTSW	1	135966840	missense	probably benign	0.16
R5818:Igfn1	UTSW	1	135966126	missense	possibly damaging	0.72
R5832:Igfn1	UTSW	1	135974795	missense	probably damaging	0.96
R5933:Igfn1	UTSW	1	135970603	nonsense	probably null
R5966:Igfn1	UTSW	1	135965414	missense	probably damaging	1.00
R6116:Igfn1	UTSW	1	135970467	missense	probably benign	0.00
R6297:Igfn1	UTSW	1	135964661	critical splice donor site	probably null
R6652:Igfn1	UTSW	1	135963871	missense	probably damaging	1.00
R6737:Igfn1	UTSW	1	135969867	missense	probably benign
R6816:Igfn1	UTSW	1	135959728	missense	probably benign	0.02
R6886:Igfn1	UTSW	1	135973460	missense	probably damaging	1.00
R6888:Igfn1	UTSW	1	135982480	missense	probably benign	0.33
R6975:Igfn1	UTSW	1	135968445	missense	probably damaging	0.96
R7105:Igfn1	UTSW	1	135984218	missense	probably benign	0.11
R7114:Igfn1	UTSW	1	135966781	missense	probably benign	0.01
R7233:Igfn1	UTSW	1	135970135	missense	probably benign	0.41
R7276:Igfn1	UTSW	1	135998638	missense	possibly damaging	0.85
R7354:Igfn1	UTSW	1	135976032	missense	possibly damaging	0.72
R7358:Igfn1	UTSW	1	135964000	missense	probably damaging	1.00
R7380:Igfn1	UTSW	1	135962008	missense	probably damaging	1.00
R7389:Igfn1	UTSW	1	135967047	missense	probably benign	0.00
R7513:Igfn1	UTSW	1	135959967	missense	probably damaging	1.00
R7718:Igfn1	UTSW	1	135969036	missense	probably benign
R7769:Igfn1	UTSW	1	135982405	missense	possibly damaging	0.85
R7810:Igfn1	UTSW	1	135974789	missense	probably damaging	0.98
R7917:Igfn1	UTSW	1	135971968	missense	probably damaging	0.99
R7952:Igfn1	UTSW	1	135963955	missense	probably damaging	0.99
R8041:Igfn1	UTSW	1	135968059	nonsense	probably null
R8233:Igfn1	UTSW	1	135968044	missense	probably benign	0.00
R8354:Igfn1	UTSW	1	135959881	missense	possibly damaging	0.61
R8363:Igfn1	UTSW	1	135963887	missense	probably benign	0.01
R8428:Igfn1	UTSW	1	135967782	missense	probably damaging	1.00
R8731:Igfn1	UTSW	1	135997836	missense	probably benign	0.02
R8756:Igfn1	UTSW	1	135967960	missense	probably benign	0.10
R8797:Igfn1	UTSW	1	135974835	missense	possibly damaging	0.93
R8913:Igfn1	UTSW	1	135963841	missense	possibly damaging	0.90
R8927:Igfn1	UTSW	1	135978246	missense	probably damaging	1.00
R8928:Igfn1	UTSW	1	135978246	missense	probably damaging	1.00
R9087:Igfn1	UTSW	1	135974868	splice site	probably null
R9109:Igfn1	UTSW	1	135998589	missense	probably benign	0.26
R9113:Igfn1	UTSW	1	135955590	missense	probably damaging	1.00
R9117:Igfn1	UTSW	1	135974790	missense	probably benign	0.03
R9205:Igfn1	UTSW	1	135975957	missense	probably damaging	0.96
R9251:Igfn1	UTSW	1	135966671	splice site	probably benign
R9260:Igfn1	UTSW	1	135979956	missense	probably benign	0.45
R9275:Igfn1	UTSW	1	135973447	missense	probably damaging	0.96
R9277:Igfn1	UTSW	1	135959782	missense	probably damaging	0.98
R9278:Igfn1	UTSW	1	135973447	missense	probably damaging	0.96
R9287:Igfn1	UTSW	1	135997806	missense	probably benign	0.33
R9298:Igfn1	UTSW	1	135998589	missense	probably benign	0.26
R9356:Igfn1	UTSW	1	135972087	nonsense	probably null
R9371:Igfn1	UTSW	1	135978263	missense	probably damaging	1.00
R9532:Igfn1	UTSW	1	135969491	missense	possibly damaging	0.61
R9653:Igfn1	UTSW	1	135955585	nonsense	probably null
R9666:Igfn1	UTSW	1	135969954	missense	possibly damaging	0.65
R9741:Igfn1	UTSW	1	135967645	missense	probably benign	0.00
R9748:Igfn1	UTSW	1	135998598	missense	possibly damaging	0.89
R9796:Igfn1	UTSW	1	135969873	missense	probably benign	0.26
Z1176:Igfn1	UTSW	1	135972000	missense	probably damaging	0.99
Z1177:Igfn1	UTSW	1	135955809	missense	probably damaging	1.00
Z1177:Igfn1	UTSW	1	135969567	missense	probably benign	0.26
Z1177:Igfn1	UTSW	1	135982426	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- AGATCTGCCTCAAATGCTTACCACG -3'
(R):5'- TGTTCTTACCTGCATCAACACAGGG -3'

Sequencing Primer
(F):5'- ACGTGGGTGTTCTAGATGATTCC -3'
(R):5'- agccatctctccagccc -3'

Posted On

2013-11-18