Incidental Mutation 'R1078:Ccdc187'
ID 85715
Institutional Source Beutler Lab
Gene Symbol Ccdc187
Ensembl Gene ENSMUSG00000048038
Gene Name coiled-coil domain containing 187
Synonyms 4932418E24Rik
MMRRC Submission 039164-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R1078 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 26161659-26184569 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26184389 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 3 (T3A)
Ref Sequence ENSEMBL: ENSMUSP00000054283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057224] [ENSMUST00000217256] [ENSMUST00000227200]
AlphaFold Q8C5V8
Predicted Effect probably damaging
Transcript: ENSMUST00000057224
AA Change: T3A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054283
Gene: ENSMUSG00000048038
AA Change: T3A

DomainStartEndE-ValueType
low complexity region 116 132 N/A INTRINSIC
low complexity region 536 557 N/A INTRINSIC
coiled coil region 605 632 N/A INTRINSIC
coiled coil region 717 745 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000217256
AA Change: T3A
Predicted Effect unknown
Transcript: ENSMUST00000227200
AA Change: T3A
Meta Mutation Damage Score 0.4587 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 66,145,698 (GRCm39) T138A unknown Het
Abi3bp T C 16: 56,474,444 (GRCm39) probably null Het
Alpk3 A T 7: 80,728,348 (GRCm39) M493L probably benign Het
Bace2 C T 16: 97,158,060 (GRCm39) A20V unknown Het
Bms1 T C 6: 118,382,182 (GRCm39) D452G probably benign Het
Ctu2 T C 8: 123,208,238 (GRCm39) V95A possibly damaging Het
Cyp2a5 A G 7: 26,534,966 (GRCm39) K60E probably benign Het
Cyp4f13 T C 17: 33,144,542 (GRCm39) H318R probably damaging Het
Dlgap5 G A 14: 47,637,023 (GRCm39) T485M probably damaging Het
Dsp C T 13: 38,367,082 (GRCm39) probably benign Het
Ell2 T C 13: 75,894,538 (GRCm39) probably benign Het
Eml2 A T 7: 18,913,687 (GRCm39) Y168F probably benign Het
Entrep1 T A 19: 23,950,939 (GRCm39) R547S probably benign Het
Ep400 C T 5: 110,883,388 (GRCm39) probably benign Het
Ercc4 C A 16: 12,948,061 (GRCm39) A336D probably benign Het
Fat4 T C 3: 39,037,235 (GRCm39) L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 (GRCm39) R925H probably damaging Het
Gfi1b A T 2: 28,503,877 (GRCm39) W108R probably damaging Het
Gtse1 C T 15: 85,746,508 (GRCm39) P108L probably damaging Het
Hfm1 A T 5: 107,026,696 (GRCm39) F140I probably damaging Het
Hyal2 T A 9: 107,449,445 (GRCm39) H400Q probably benign Het
Igfn1 A G 1: 135,902,585 (GRCm39) Y371H probably damaging Het
Il22b T G 10: 118,126,056 (GRCm39) *180C probably null Het
Kdm2b T C 5: 123,099,604 (GRCm39) T118A possibly damaging Het
Lama5 A T 2: 179,821,557 (GRCm39) probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lmo7 C T 14: 102,157,910 (GRCm39) probably benign Het
Lrrc37a G T 11: 103,388,457 (GRCm39) P2323T unknown Het
Lrrc38 A G 4: 143,077,088 (GRCm39) Y117C probably benign Het
Myo1e T C 9: 70,291,281 (GRCm39) V1024A probably benign Het
Myrfl T C 10: 116,612,637 (GRCm39) N904S possibly damaging Het
Or12d13 T A 17: 37,647,917 (GRCm39) I69F probably damaging Het
Or4k47 T C 2: 111,451,690 (GRCm39) H243R probably damaging Het
Or9g4b T C 2: 85,616,437 (GRCm39) V194A possibly damaging Het
Pld4 A T 12: 112,729,876 (GRCm39) I53F probably benign Het
Plekhg4 T A 8: 106,108,309 (GRCm39) C1117* probably null Het
Prss39 G A 1: 34,541,167 (GRCm39) E224K probably benign Het
Psme1 G T 14: 55,818,107 (GRCm39) G149V probably damaging Het
Sanbr A C 11: 23,561,762 (GRCm39) I358S probably benign Het
Soat2 T A 15: 102,061,573 (GRCm39) probably null Het
Stab2 C T 10: 86,742,997 (GRCm39) probably null Het
Tcf7l2 A G 19: 55,731,627 (GRCm39) T127A probably benign Het
Tcp1 T C 17: 13,142,091 (GRCm39) probably benign Het
Thbs4 G A 13: 92,899,434 (GRCm39) probably benign Het
Tmf1 T C 6: 97,150,261 (GRCm39) D482G probably damaging Het
Trim66 G T 7: 109,071,526 (GRCm39) P591H probably damaging Het
Umodl1 T C 17: 31,178,347 (GRCm39) S108P probably benign Het
Unc79 T G 12: 103,041,112 (GRCm39) M715R probably benign Het
Usp34 C A 11: 23,383,175 (GRCm39) probably benign Het
Utrn T G 10: 12,331,310 (GRCm39) probably null Het
Zfp830 T C 11: 82,656,165 (GRCm39) probably null Het
Other mutations in Ccdc187
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Ccdc187 APN 2 26,170,960 (GRCm39) missense probably benign
IGL02989:Ccdc187 APN 2 26,166,443 (GRCm39) missense possibly damaging 0.92
IGL03017:Ccdc187 APN 2 26,170,978 (GRCm39) missense probably benign
IGL03059:Ccdc187 APN 2 26,184,253 (GRCm39) missense probably null 1.00
IGL03117:Ccdc187 APN 2 26,177,980 (GRCm39) missense possibly damaging 0.95
R0026:Ccdc187 UTSW 2 26,171,365 (GRCm39) missense probably benign 0.00
R0144:Ccdc187 UTSW 2 26,166,215 (GRCm39) missense probably damaging 0.98
R1226:Ccdc187 UTSW 2 26,166,133 (GRCm39) missense probably damaging 0.99
R1624:Ccdc187 UTSW 2 26,171,087 (GRCm39) missense probably benign
R1733:Ccdc187 UTSW 2 26,183,670 (GRCm39) missense possibly damaging 0.93
R1851:Ccdc187 UTSW 2 26,166,080 (GRCm39) missense probably benign 0.17
R2304:Ccdc187 UTSW 2 26,171,029 (GRCm39) missense possibly damaging 0.94
R4278:Ccdc187 UTSW 2 26,172,239 (GRCm39) intron probably benign
R4344:Ccdc187 UTSW 2 26,170,681 (GRCm39) missense probably damaging 1.00
R5151:Ccdc187 UTSW 2 26,183,451 (GRCm39) missense probably damaging 1.00
R5416:Ccdc187 UTSW 2 26,166,104 (GRCm39) missense possibly damaging 0.87
R5537:Ccdc187 UTSW 2 26,166,237 (GRCm39) missense probably benign 0.32
R5761:Ccdc187 UTSW 2 26,166,104 (GRCm39) missense possibly damaging 0.87
R5762:Ccdc187 UTSW 2 26,166,104 (GRCm39) missense possibly damaging 0.87
R5865:Ccdc187 UTSW 2 26,183,380 (GRCm39) missense probably benign 0.00
R5925:Ccdc187 UTSW 2 26,183,593 (GRCm39) missense probably benign
R6261:Ccdc187 UTSW 2 26,166,215 (GRCm39) missense probably damaging 0.98
R6803:Ccdc187 UTSW 2 26,179,791 (GRCm39) missense probably benign 0.02
R6888:Ccdc187 UTSW 2 26,179,746 (GRCm39) missense probably damaging 0.98
R6958:Ccdc187 UTSW 2 26,179,731 (GRCm39) missense probably benign
R7006:Ccdc187 UTSW 2 26,171,102 (GRCm39) missense probably benign 0.05
R7358:Ccdc187 UTSW 2 26,146,007 (GRCm39) missense probably damaging 0.97
R7818:Ccdc187 UTSW 2 26,166,186 (GRCm39) missense possibly damaging 0.61
R8048:Ccdc187 UTSW 2 26,183,526 (GRCm39) missense possibly damaging 0.53
R8327:Ccdc187 UTSW 2 26,170,630 (GRCm39) missense probably benign 0.01
R8353:Ccdc187 UTSW 2 26,166,458 (GRCm39) missense probably damaging 0.99
R8425:Ccdc187 UTSW 2 26,171,548 (GRCm39) missense probably damaging 0.99
R8453:Ccdc187 UTSW 2 26,166,458 (GRCm39) missense probably damaging 0.99
R8461:Ccdc187 UTSW 2 26,183,814 (GRCm39) missense probably damaging 0.99
R8534:Ccdc187 UTSW 2 26,165,577 (GRCm39) missense possibly damaging 0.61
R8694:Ccdc187 UTSW 2 26,165,505 (GRCm39) missense probably benign 0.02
R8745:Ccdc187 UTSW 2 26,170,526 (GRCm39) missense probably damaging 0.99
R8958:Ccdc187 UTSW 2 26,165,577 (GRCm39) missense probably benign 0.02
R8972:Ccdc187 UTSW 2 26,171,079 (GRCm39) missense probably benign
R9214:Ccdc187 UTSW 2 26,183,409 (GRCm39) missense probably benign 0.19
R9454:Ccdc187 UTSW 2 26,166,114 (GRCm39) missense possibly damaging 0.94
R9542:Ccdc187 UTSW 2 26,145,930 (GRCm39) missense possibly damaging 0.66
R9562:Ccdc187 UTSW 2 26,183,698 (GRCm39) missense possibly damaging 0.90
R9565:Ccdc187 UTSW 2 26,183,698 (GRCm39) missense possibly damaging 0.90
R9601:Ccdc187 UTSW 2 26,143,445 (GRCm39) missense possibly damaging 0.90
R9702:Ccdc187 UTSW 2 26,172,222 (GRCm39) missense unknown
R9727:Ccdc187 UTSW 2 26,171,204 (GRCm39) missense probably damaging 0.99
R9790:Ccdc187 UTSW 2 26,171,227 (GRCm39) missense probably benign
R9791:Ccdc187 UTSW 2 26,171,227 (GRCm39) missense probably benign
Z1176:Ccdc187 UTSW 2 26,171,519 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCTCTTGTCCTGTCCACACAAACAC -3'
(R):5'- GGAAATCCCACAGCCATTGTCTACC -3'

Sequencing Primer
(F):5'- TGTCCACACAAACACTACCTGG -3'
(R):5'- TCAATGACTGTCCTGAGCATC -3'
Posted On 2013-11-18