Incidental Mutation 'R1078:Lama5'
ID85719
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Namelaminin, alpha 5
Synonyms
MMRRC Submission 039164-MU
Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1078 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location180176373-180225859 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 180179764 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000050076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]
PDB Structure
Crystal structure of the proteasomal Rpn13 PRU-domain [X-RAY DIFFRACTION]
Complex Structures of Mouse Rpn13 (22-130aa) and ubiquitin [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000015791
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000061437
SMART Domains Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

DomainStartEndE-ValueType
Pfam:Proteasom_Rpn13 29 111 3.5e-35 PFAM
low complexity region 135 161 N/A INTRINSIC
low complexity region 173 254 N/A INTRINSIC
Pfam:RPN13_C 268 381 7.3e-38 PFAM
low complexity region 390 403 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185089
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 180176543 unclassified probably benign
IGL01370:Lama5 APN 2 180197400 missense possibly damaging 0.87
IGL01474:Lama5 APN 2 180196570 missense probably damaging 1.00
IGL01614:Lama5 APN 2 180180864 missense probably damaging 1.00
IGL01941:Lama5 APN 2 180192392 missense possibly damaging 0.71
IGL01953:Lama5 APN 2 180190704 missense probably damaging 0.97
IGL02093:Lama5 APN 2 180188587 missense probably damaging 1.00
IGL02197:Lama5 APN 2 180207219 missense possibly damaging 0.82
IGL02308:Lama5 APN 2 180190327 splice site probably benign
IGL02314:Lama5 APN 2 180194482 splice site probably benign
IGL02317:Lama5 APN 2 180191319 missense probably damaging 1.00
IGL02354:Lama5 APN 2 180193884 nonsense probably null
IGL02361:Lama5 APN 2 180193884 nonsense probably null
IGL02557:Lama5 APN 2 180190932 nonsense probably null
IGL03026:Lama5 APN 2 180195967 missense probably benign 0.34
IGL03160:Lama5 APN 2 180180335 missense probably damaging 1.00
IGL03238:Lama5 APN 2 180188574 missense probably benign
IGL03390:Lama5 APN 2 180207218 missense probably damaging 1.00
Salty UTSW 2 180181651 missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 180189445 missense possibly damaging 0.89
R0003:Lama5 UTSW 2 180178079 unclassified probably null
R0056:Lama5 UTSW 2 180187106 intron probably benign
R0147:Lama5 UTSW 2 180190406 missense probably benign
R0148:Lama5 UTSW 2 180190406 missense probably benign
R0310:Lama5 UTSW 2 180181566 splice site probably benign
R0326:Lama5 UTSW 2 180182426 missense possibly damaging 0.90
R0368:Lama5 UTSW 2 180181230 nonsense probably null
R0479:Lama5 UTSW 2 180184457 missense probably benign 0.03
R0490:Lama5 UTSW 2 180180169 missense possibly damaging 0.90
R0636:Lama5 UTSW 2 180189331 critical splice donor site probably null
R0704:Lama5 UTSW 2 180179484 missense possibly damaging 0.84
R0733:Lama5 UTSW 2 180180718 missense possibly damaging 0.83
R1017:Lama5 UTSW 2 180195420 missense probably damaging 1.00
R1294:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1423:Lama5 UTSW 2 180195641 missense probably damaging 1.00
R1438:Lama5 UTSW 2 180182800 missense probably benign 0.01
R1447:Lama5 UTSW 2 180185878 missense probably damaging 0.99
R1540:Lama5 UTSW 2 180180151 missense probably benign
R1601:Lama5 UTSW 2 180197745 missense probably damaging 1.00
R1624:Lama5 UTSW 2 180206758 missense probably benign 0.02
R1674:Lama5 UTSW 2 180201987 missense probably benign 0.00
R1687:Lama5 UTSW 2 180194066 missense probably benign 0.00
R1696:Lama5 UTSW 2 180202486 missense probably damaging 1.00
R1701:Lama5 UTSW 2 180221369 missense probably damaging 1.00
R1778:Lama5 UTSW 2 180195481 splice site probably benign
R1936:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1939:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1940:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1953:Lama5 UTSW 2 180190747 missense possibly damaging 0.94
R1966:Lama5 UTSW 2 180188352 missense probably damaging 1.00
R2024:Lama5 UTSW 2 180179130 missense probably benign 0.00
R2079:Lama5 UTSW 2 180225508 missense possibly damaging 0.68
R2115:Lama5 UTSW 2 180186885 missense probably damaging 1.00
R2173:Lama5 UTSW 2 180196242 missense probably benign 0.00
R2272:Lama5 UTSW 2 180178603 missense possibly damaging 0.93
R2357:Lama5 UTSW 2 180180097 missense probably benign 0.01
R2860:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2861:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2939:Lama5 UTSW 2 180198954 missense probably damaging 1.00
R3053:Lama5 UTSW 2 180183067 missense probably damaging 0.99
R3430:Lama5 UTSW 2 180196317 missense probably benign 0.00
R3752:Lama5 UTSW 2 180187222 missense probably damaging 1.00
R3782:Lama5 UTSW 2 180194563 missense possibly damaging 0.57
R3901:Lama5 UTSW 2 180182351 splice site probably benign
R4248:Lama5 UTSW 2 180180427 missense possibly damaging 0.84
R4626:Lama5 UTSW 2 180184460 missense probably damaging 0.98
R4638:Lama5 UTSW 2 180190413 missense possibly damaging 0.89
R4669:Lama5 UTSW 2 180180637 missense probably damaging 1.00
R4673:Lama5 UTSW 2 180199266 missense probably damaging 1.00
R4677:Lama5 UTSW 2 180179366 missense possibly damaging 0.69
R4701:Lama5 UTSW 2 180191696 missense probably damaging 1.00
R4774:Lama5 UTSW 2 180185941 missense probably damaging 1.00
R4880:Lama5 UTSW 2 180177068 unclassified probably benign
R4923:Lama5 UTSW 2 180184149 missense probably benign 0.18
R4960:Lama5 UTSW 2 180208252 critical splice donor site probably null
R4983:Lama5 UTSW 2 180193449 missense probably benign 0.13
R5061:Lama5 UTSW 2 180198786 nonsense probably null
R5080:Lama5 UTSW 2 180207200 nonsense probably null
R5135:Lama5 UTSW 2 180202220 missense possibly damaging 0.89
R5206:Lama5 UTSW 2 180191304 missense probably damaging 1.00
R5296:Lama5 UTSW 2 180193801 missense probably damaging 1.00
R5319:Lama5 UTSW 2 180181118 missense probably damaging 1.00
R5355:Lama5 UTSW 2 180181651 missense possibly damaging 0.84
R5388:Lama5 UTSW 2 180190746 missense possibly damaging 0.83
R5528:Lama5 UTSW 2 180194563 missense probably benign 0.21
R5536:Lama5 UTSW 2 180189349 missense probably damaging 0.99
R5658:Lama5 UTSW 2 180208276 nonsense probably null
R5823:Lama5 UTSW 2 180192492 missense probably benign 0.04
R5885:Lama5 UTSW 2 180201831 missense probably damaging 1.00
R5889:Lama5 UTSW 2 180193674 intron probably benign
R5912:Lama5 UTSW 2 180195475 missense probably damaging 1.00
R5955:Lama5 UTSW 2 180197474 missense probably damaging 1.00
R6015:Lama5 UTSW 2 180185392 missense probably benign 0.36
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6191:Lama5 UTSW 2 180180611 missense probably damaging 0.98
R6191:Lama5 UTSW 2 180185959 missense probably damaging 1.00
R6359:Lama5 UTSW 2 180195982 missense probably benign 0.01
R6385:Lama5 UTSW 2 180196533 missense probably damaging 1.00
R6406:Lama5 UTSW 2 180197464 nonsense probably null
R6552:Lama5 UTSW 2 180181154 missense probably damaging 0.98
R6632:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6633:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6645:Lama5 UTSW 2 180179670 missense probably damaging 1.00
R6731:Lama5 UTSW 2 180188574 missense probably benign 0.09
R6744:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6798:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6799:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6801:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6851:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6869:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6881:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6882:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6884:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R7022:Lama5 UTSW 2 180180731 missense probably damaging 1.00
R7204:Lama5 UTSW 2 180202177 missense probably damaging 1.00
R7207:Lama5 UTSW 2 180207084 missense probably damaging 0.98
R7282:Lama5 UTSW 2 180201795 missense probably damaging 1.00
R7367:Lama5 UTSW 2 180192958 missense probably benign 0.01
R7410:Lama5 UTSW 2 180202390 critical splice donor site probably null
RF020:Lama5 UTSW 2 180196178 missense probably benign
X0065:Lama5 UTSW 2 180181731 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- GCCTTAATACCCTTGATGCAGCCAC -3'
(R):5'- GCTTTGAGAAGCAGTTCAGCAACAC -3'

Sequencing Primer
(F):5'- ACACCAGTCAGGTCGTGAG -3'
(R):5'- TTTCCTCAAGCAAGAGGTACAG -3'
Posted On2013-11-18