Mutagenetix > Incidental Mutation

Incidental Mutation 'R1078:Lama5'

85719

Institutional Source

Beutler Lab

Gene Symbol

Lama5

Ensembl Gene

ENSMUSG00000015647

Gene Name

laminin, alpha 5

Synonyms

MMRRC Submission

039164-MU

Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1078 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

180176373-180225859 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

A to T at 180179764 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000050076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015791] [ENSMUST00000061437]

AlphaFold

no structure available at present

PDB Structure

Crystal structure of the proteasomal Rpn13 PRU-domain [X-RAY DIFFRACTION]
Complex Structures of Mouse Rpn13 (22-130aa) and ubiquitin [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000015791

SMART Domains

Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
LamNT	44	303	1.06e-132	SMART
EGF_Lam	305	361	4.35e-6	SMART
EGF_Lam	364	431	5.78e-11	SMART
EGF_Lam	434	476	1.32e-5	SMART
EGF_Lam	500	544	8.63e-10	SMART
EGF_Lam	547	590	1.16e-10	SMART
EGF_Lam	593	635	4.63e-10	SMART
EGF_Lam	638	680	6.25e-7	SMART
EGF_Lam	683	726	3.1e-11	SMART
EGF_Lam	730	779	2.99e-4	SMART
EGF_Lam	782	831	4.66e-6	SMART
EGF_Lam	834	878	3.48e-5	SMART
low complexity region	1261	1273	N/A	INTRINSIC
EGF_Lam	1443	1486	7.01e-10	SMART
EGF_like	1489	1530	3.64e-1	SMART
EGF_Lam	1533	1579	8.56e-14	SMART
EGF_Lam	1582	1630	1.86e-14	SMART
LamB	1689	1819	5.86e-61	SMART
EGF_like	1818	1862	2.74e0	SMART
EGF_Lam	1865	1912	3.32e-11	SMART
EGF_Lam	1915	1968	1.61e-9	SMART
EGF_Lam	1971	2022	6.39e-13	SMART
EGF_Lam	2025	2069	1.94e-12	SMART
EGF_Lam	2072	2116	1.35e-11	SMART
EGF_like	2103	2145	3.1e1	SMART
EGF_Lam	2119	2166	1.18e-2	SMART
Pfam:Laminin_I	2189	2453	1.7e-65	PFAM
low complexity region	2532	2548	N/A	INTRINSIC
low complexity region	2557	2569	N/A	INTRINSIC
low complexity region	2632	2641	N/A	INTRINSIC
low complexity region	2663	2676	N/A	INTRINSIC
LamG	2760	2912	3.97e-8	SMART
LamG	2966	3103	1.78e-10	SMART
LamG	3149	3274	1.11e-20	SMART
LamG	3359	3497	4.05e-23	SMART
LamG	3539	3670	3e-26	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000061437

SMART Domains

Protein: ENSMUSP00000050076
Gene: ENSMUSG00000039041

Domain	Start	End	E-Value	Type
Pfam:Proteasom_Rpn13	29	111	3.5e-35	PFAM
low complexity region	135	161	N/A	INTRINSIC
low complexity region	173	254	N/A	INTRINSIC
Pfam:RPN13_C	268	381	7.3e-38	PFAM
low complexity region	390	403	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123906

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128029

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130796

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145230

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147383

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149812

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152540

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185089

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.4%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]

Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,611,762	I358S	probably benign	Het
9130230L23Rik	T	C	5: 65,988,355	T138A	unknown	Het
Abi3bp	T	C	16: 56,654,081		probably null	Het
Alpk3	A	T	7: 81,078,600	M493L	probably benign	Het
Bace2	C	T	16: 97,356,860	A20V	unknown	Het
Bms1	T	C	6: 118,405,221	D452G	probably benign	Het
Ccdc187	T	C	2: 26,294,377	T3A	probably damaging	Het
Ctu2	T	C	8: 122,481,499	V95A	possibly damaging	Het
Cyp2a5	A	G	7: 26,835,541	K60E	probably benign	Het
Cyp4f13	T	C	17: 32,925,568	H318R	probably damaging	Het
Dlgap5	G	A	14: 47,399,566	T485M	probably damaging	Het
Dsp	C	T	13: 38,183,106		probably benign	Het
Ell2	T	C	13: 75,746,419		probably benign	Het
Eml2	A	T	7: 19,179,762	Y168F	probably benign	Het
Ep400	C	T	5: 110,735,522		probably benign	Het
Ercc4	C	A	16: 13,130,197	A336D	probably benign	Het
Fam189a2	T	A	19: 23,973,575	R547S	probably benign	Het
Fat4	T	C	3: 38,983,086	L3629S	probably benign	Het
Gabbr2	C	T	4: 46,664,833	R925H	probably damaging	Het
Gfi1b	A	T	2: 28,613,865	W108R	probably damaging	Het
Gtse1	C	T	15: 85,862,307	P108L	probably damaging	Het
Hfm1	A	T	5: 106,878,830	F140I	probably damaging	Het
Hyal2	T	A	9: 107,572,246	H400Q	probably benign	Het
Igfn1	A	G	1: 135,974,847	Y371H	probably damaging	Het
Iltifb	T	G	10: 118,290,151	*180C	probably null	Het
Kdm2b	T	C	5: 122,961,541	T118A	possibly damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lmo7	C	T	14: 101,920,474		probably benign	Het
Lrrc37a	G	T	11: 103,497,631	P2323T	unknown	Het
Lrrc38	A	G	4: 143,350,518	Y117C	probably benign	Het
Myo1e	T	C	9: 70,383,999	V1024A	probably benign	Het
Myrfl	T	C	10: 116,776,732	N904S	possibly damaging	Het
Olfr1015	T	C	2: 85,786,093	V194A	possibly damaging	Het
Olfr103	T	A	17: 37,337,026	I69F	probably damaging	Het
Olfr1297	T	C	2: 111,621,345	H243R	probably damaging	Het
Pld4	A	T	12: 112,763,442	I53F	probably benign	Het
Plekhg4	T	A	8: 105,381,677	C1117*	probably null	Het
Prss39	G	A	1: 34,502,086	E224K	probably benign	Het
Psme1	G	T	14: 55,580,650	G149V	probably damaging	Het
Soat2	T	A	15: 102,153,138		probably null	Het
Stab2	C	T	10: 86,907,133		probably null	Het
Tcf7l2	A	G	19: 55,743,195	T127A	probably benign	Het
Tcp1	T	C	17: 12,923,204		probably benign	Het
Thbs4	G	A	13: 92,762,926		probably benign	Het
Tmf1	T	C	6: 97,173,300	D482G	probably damaging	Het
Trim66	G	T	7: 109,472,319	P591H	probably damaging	Het
Umodl1	T	C	17: 30,959,373	S108P	probably benign	Het
Unc79	T	G	12: 103,074,853	M715R	probably benign	Het
Usp34	C	A	11: 23,433,175		probably benign	Het
Utrn	T	G	10: 12,455,566		probably null	Het
Zfp830	T	C	11: 82,765,339		probably null	Het

Other mutations in Lama5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Lama5	APN	2	180176543	unclassified	probably benign
IGL01370:Lama5	APN	2	180197400	missense	possibly damaging	0.87
IGL01474:Lama5	APN	2	180196570	missense	probably damaging	1.00
IGL01614:Lama5	APN	2	180180864	missense	probably damaging	1.00
IGL01941:Lama5	APN	2	180192392	missense	possibly damaging	0.71
IGL01953:Lama5	APN	2	180190704	missense	probably damaging	0.97
IGL02093:Lama5	APN	2	180188587	missense	probably damaging	1.00
IGL02197:Lama5	APN	2	180207219	missense	possibly damaging	0.82
IGL02308:Lama5	APN	2	180190327	splice site	probably benign
IGL02314:Lama5	APN	2	180194482	splice site	probably benign
IGL02317:Lama5	APN	2	180191319	missense	probably damaging	1.00
IGL02354:Lama5	APN	2	180193884	nonsense	probably null
IGL02361:Lama5	APN	2	180193884	nonsense	probably null
IGL02557:Lama5	APN	2	180190932	nonsense	probably null
IGL03026:Lama5	APN	2	180195967	missense	probably benign	0.34
IGL03160:Lama5	APN	2	180180335	missense	probably damaging	1.00
IGL03238:Lama5	APN	2	180188574	missense	probably benign
IGL03390:Lama5	APN	2	180207218	missense	probably damaging	1.00
blancmange	UTSW	2	180180611	missense	probably damaging	0.98
cupcake	UTSW	2	180185959	missense	probably damaging	1.00
layercake	UTSW	2	180180718	missense	possibly damaging	0.83
poundcake	UTSW	2	180195608	missense	probably damaging	1.00
Salty	UTSW	2	180181651	missense	possibly damaging	0.84
PIT4378001:Lama5	UTSW	2	180189445	missense	possibly damaging	0.89
R0003:Lama5	UTSW	2	180178079	splice site	probably null
R0056:Lama5	UTSW	2	180187106	intron	probably benign
R0147:Lama5	UTSW	2	180190406	missense	probably benign
R0148:Lama5	UTSW	2	180190406	missense	probably benign
R0310:Lama5	UTSW	2	180181566	splice site	probably benign
R0326:Lama5	UTSW	2	180182426	missense	possibly damaging	0.90
R0368:Lama5	UTSW	2	180181230	nonsense	probably null
R0479:Lama5	UTSW	2	180184457	missense	probably benign	0.03
R0490:Lama5	UTSW	2	180180169	missense	possibly damaging	0.90
R0636:Lama5	UTSW	2	180189331	critical splice donor site	probably null
R0704:Lama5	UTSW	2	180179484	missense	possibly damaging	0.84
R0733:Lama5	UTSW	2	180180718	missense	possibly damaging	0.83
R1017:Lama5	UTSW	2	180195420	missense	probably damaging	1.00
R1294:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1423:Lama5	UTSW	2	180195641	missense	probably damaging	1.00
R1438:Lama5	UTSW	2	180182800	missense	probably benign	0.01
R1447:Lama5	UTSW	2	180185878	missense	probably damaging	0.99
R1540:Lama5	UTSW	2	180180151	missense	probably benign
R1601:Lama5	UTSW	2	180197745	missense	probably damaging	1.00
R1624:Lama5	UTSW	2	180206758	missense	probably benign	0.02
R1674:Lama5	UTSW	2	180201987	missense	probably benign	0.00
R1687:Lama5	UTSW	2	180194066	missense	probably benign	0.00
R1696:Lama5	UTSW	2	180202486	missense	probably damaging	1.00
R1701:Lama5	UTSW	2	180221369	missense	probably damaging	1.00
R1778:Lama5	UTSW	2	180195481	splice site	probably benign
R1936:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1939:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1940:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R1953:Lama5	UTSW	2	180190747	missense	possibly damaging	0.94
R1966:Lama5	UTSW	2	180188352	missense	probably damaging	1.00
R2024:Lama5	UTSW	2	180179130	missense	probably benign	0.00
R2079:Lama5	UTSW	2	180225508	missense	possibly damaging	0.68
R2115:Lama5	UTSW	2	180186885	missense	probably damaging	1.00
R2173:Lama5	UTSW	2	180196242	missense	probably benign	0.00
R2272:Lama5	UTSW	2	180178603	missense	possibly damaging	0.93
R2357:Lama5	UTSW	2	180180097	missense	probably benign	0.01
R2860:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2861:Lama5	UTSW	2	180187247	missense	probably benign	0.00
R2939:Lama5	UTSW	2	180198954	missense	probably damaging	1.00
R3053:Lama5	UTSW	2	180183067	missense	probably damaging	0.99
R3430:Lama5	UTSW	2	180196317	missense	probably benign	0.00
R3752:Lama5	UTSW	2	180187222	missense	probably damaging	1.00
R3782:Lama5	UTSW	2	180194563	missense	possibly damaging	0.57
R3901:Lama5	UTSW	2	180182351	splice site	probably benign
R4248:Lama5	UTSW	2	180180427	missense	possibly damaging	0.84
R4626:Lama5	UTSW	2	180184460	missense	probably damaging	0.98
R4638:Lama5	UTSW	2	180190413	missense	possibly damaging	0.89
R4669:Lama5	UTSW	2	180180637	missense	probably damaging	1.00
R4673:Lama5	UTSW	2	180199266	missense	probably damaging	1.00
R4677:Lama5	UTSW	2	180179366	missense	possibly damaging	0.69
R4701:Lama5	UTSW	2	180191696	missense	probably damaging	1.00
R4774:Lama5	UTSW	2	180185941	missense	probably damaging	1.00
R4880:Lama5	UTSW	2	180177068	unclassified	probably benign
R4923:Lama5	UTSW	2	180184149	missense	probably benign	0.18
R4960:Lama5	UTSW	2	180208252	critical splice donor site	probably null
R4983:Lama5	UTSW	2	180193449	missense	probably benign	0.13
R5061:Lama5	UTSW	2	180198786	nonsense	probably null
R5080:Lama5	UTSW	2	180207200	nonsense	probably null
R5135:Lama5	UTSW	2	180202220	missense	possibly damaging	0.89
R5206:Lama5	UTSW	2	180191304	missense	probably damaging	1.00
R5296:Lama5	UTSW	2	180193801	missense	probably damaging	1.00
R5319:Lama5	UTSW	2	180181118	missense	probably damaging	1.00
R5355:Lama5	UTSW	2	180181651	missense	possibly damaging	0.84
R5388:Lama5	UTSW	2	180190746	missense	possibly damaging	0.83
R5528:Lama5	UTSW	2	180194563	missense	probably benign	0.21
R5536:Lama5	UTSW	2	180189349	missense	probably damaging	0.99
R5658:Lama5	UTSW	2	180208276	nonsense	probably null
R5823:Lama5	UTSW	2	180192492	missense	probably benign	0.04
R5885:Lama5	UTSW	2	180201831	missense	probably damaging	1.00
R5889:Lama5	UTSW	2	180193674	intron	probably benign
R5912:Lama5	UTSW	2	180195475	missense	probably damaging	1.00
R5955:Lama5	UTSW	2	180197474	missense	probably damaging	1.00
R6015:Lama5	UTSW	2	180185392	missense	probably benign	0.36
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6037:Lama5	UTSW	2	180207013	missense	probably damaging	1.00
R6191:Lama5	UTSW	2	180180611	missense	probably damaging	0.98
R6191:Lama5	UTSW	2	180185959	missense	probably damaging	1.00
R6359:Lama5	UTSW	2	180195982	missense	probably benign	0.01
R6385:Lama5	UTSW	2	180196533	missense	probably damaging	1.00
R6406:Lama5	UTSW	2	180197464	nonsense	probably null
R6552:Lama5	UTSW	2	180181154	missense	probably damaging	0.98
R6632:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6633:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6645:Lama5	UTSW	2	180179670	missense	probably damaging	1.00
R6731:Lama5	UTSW	2	180188574	missense	probably benign	0.09
R6744:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6798:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6799:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6801:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6851:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6869:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6881:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6882:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R6884:Lama5	UTSW	2	180191662	missense	probably damaging	1.00
R7022:Lama5	UTSW	2	180180731	missense	probably damaging	1.00
R7204:Lama5	UTSW	2	180202177	missense	probably damaging	1.00
R7207:Lama5	UTSW	2	180207084	missense	probably damaging	0.98
R7282:Lama5	UTSW	2	180201795	missense	probably damaging	1.00
R7367:Lama5	UTSW	2	180192958	missense	probably benign	0.01
R7410:Lama5	UTSW	2	180202390	critical splice donor site	probably null
R7699:Lama5	UTSW	2	180180861	missense	probably damaging	1.00
R7849:Lama5	UTSW	2	180201812	missense	probably damaging	1.00
R7909:Lama5	UTSW	2	180192276	missense	possibly damaging	0.95
R7948:Lama5	UTSW	2	180202201	missense	probably damaging	1.00
R8153:Lama5	UTSW	2	180187931	missense	probably benign	0.37
R8317:Lama5	UTSW	2	180206991	missense	probably damaging	1.00
R8351:Lama5	UTSW	2	180195608	missense	probably damaging	1.00
R8370:Lama5	UTSW	2	180201487	missense	possibly damaging	0.80
R8398:Lama5	UTSW	2	180197034	critical splice donor site	probably null
R8401:Lama5	UTSW	2	180198787	missense	probably damaging	1.00
R8404:Lama5	UTSW	2	180195222	missense	probably damaging	1.00
R8502:Lama5	UTSW	2	180195222	missense	probably damaging	1.00
R8694:Lama5	UTSW	2	180180884	missense	probably damaging	0.98
R8705:Lama5	UTSW	2	180178561	missense	probably damaging	1.00
R8732:Lama5	UTSW	2	180186688	missense	probably damaging	1.00
R8755:Lama5	UTSW	2	180190921	missense	probably benign	0.00
R8786:Lama5	UTSW	2	180196307	missense	probably damaging	1.00
R8926:Lama5	UTSW	2	180193990	missense	probably benign	0.08
R8928:Lama5	UTSW	2	180202039	missense	probably damaging	1.00
R8953:Lama5	UTSW	2	180193520	missense	probably damaging	0.99
R8958:Lama5	UTSW	2	180193799	missense	probably benign
R9002:Lama5	UTSW	2	180196518	missense	probably damaging	1.00
R9081:Lama5	UTSW	2	180192137	nonsense	probably null
R9165:Lama5	UTSW	2	180179493	missense	probably damaging	0.99
R9233:Lama5	UTSW	2	180198709	nonsense	probably null
R9264:Lama5	UTSW	2	180196478	splice site	probably benign
R9311:Lama5	UTSW	2	180196482	critical splice donor site	probably null
R9443:Lama5	UTSW	2	180201729	missense	probably benign	0.00
R9488:Lama5	UTSW	2	180181441	missense	possibly damaging	0.95
R9674:Lama5	UTSW	2	180198474	critical splice donor site	probably null
R9684:Lama5	UTSW	2	180207245	missense	probably damaging	1.00
R9749:Lama5	UTSW	2	180183640	missense	probably benign	0.00
RF020:Lama5	UTSW	2	180196178	missense	probably benign
X0065:Lama5	UTSW	2	180181731	missense	probably benign	0.26
Z1177:Lama5	UTSW	2	180183630	missense	probably benign	0.03
Z1177:Lama5	UTSW	2	180189419	missense	probably damaging	1.00
Z1177:Lama5	UTSW	2	180190714	missense	possibly damaging	0.95
Z1177:Lama5	UTSW	2	180198810	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTTAATACCCTTGATGCAGCCAC -3'
(R):5'- GCTTTGAGAAGCAGTTCAGCAACAC -3'

Sequencing Primer
(F):5'- ACACCAGTCAGGTCGTGAG -3'
(R):5'- TTTCCTCAAGCAAGAGGTACAG -3'

Posted On

2013-11-18