Mutagenetix > Incidental Mutation

Incidental Mutation 'R1078:Gabbr2'

85721

Institutional Source

Beutler Lab

Gene Symbol

Gabbr2

Ensembl Gene

ENSMUSG00000039809

Gene Name

gamma-aminobutyric acid (GABA) B receptor, 2

Synonyms

Gpr51, Gababr2, LOC242425

MMRRC Submission

039164-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R1078 (G1)

Quality Score

207

Status

Validated

Chromosome

Chromosomal Location

46662305-46991873 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46664833 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 925 (R925H)

Ref Sequence

ENSEMBL: ENSMUSP00000103378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107749]

AlphaFold

Q80T41

Predicted Effect

probably damaging
Transcript: ENSMUST00000107749
AA Change: R925H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000103378
Gene: ENSMUSG00000039809
AA Change: R925H

Domain	Start	End	E-Value	Type
signal peptide	1	40	N/A	INTRINSIC
Pfam:Peripla_BP_6	59	434	1.5e-15	PFAM
Pfam:ANF_receptor	75	429	2e-51	PFAM
Pfam:7tm_3	492	745	6.4e-57	PFAM
PDB:4PAS\|B	778	818	1e-18	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129328

Meta Mutation Damage Score

0.0956

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.4%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The multi-pass membrane protein encoded by this gene belongs to the G-protein coupled receptor 3 family and GABA-B receptor subfamily. The GABA-B receptors inhibit neuronal activity through G protein-coupled second-messenger systems, which regulate the release of neurotransmitters, and the activity of ion channels and adenylyl cyclase. This receptor subunit forms an active heterodimeric complex with GABA-B receptor subunit 1, neither of which is effective on its own. Allelic variants of this gene have been associated with nicotine dependence.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous mutation of this gene results in clonic seizures, hyperactivity, hyperalgesia in response to thermal or mechanical stimuli, increased anxiety, and decreased depression-related behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,611,762	I358S	probably benign	Het
9130230L23Rik	T	C	5: 65,988,355	T138A	unknown	Het
Abi3bp	T	C	16: 56,654,081		probably null	Het
Alpk3	A	T	7: 81,078,600	M493L	probably benign	Het
Bace2	C	T	16: 97,356,860	A20V	unknown	Het
Bms1	T	C	6: 118,405,221	D452G	probably benign	Het
Ccdc187	T	C	2: 26,294,377	T3A	probably damaging	Het
Ctu2	T	C	8: 122,481,499	V95A	possibly damaging	Het
Cyp2a5	A	G	7: 26,835,541	K60E	probably benign	Het
Cyp4f13	T	C	17: 32,925,568	H318R	probably damaging	Het
Dlgap5	G	A	14: 47,399,566	T485M	probably damaging	Het
Dsp	C	T	13: 38,183,106		probably benign	Het
Ell2	T	C	13: 75,746,419		probably benign	Het
Eml2	A	T	7: 19,179,762	Y168F	probably benign	Het
Ep400	C	T	5: 110,735,522		probably benign	Het
Ercc4	C	A	16: 13,130,197	A336D	probably benign	Het
Fam189a2	T	A	19: 23,973,575	R547S	probably benign	Het
Fat4	T	C	3: 38,983,086	L3629S	probably benign	Het
Gfi1b	A	T	2: 28,613,865	W108R	probably damaging	Het
Gtse1	C	T	15: 85,862,307	P108L	probably damaging	Het
Hfm1	A	T	5: 106,878,830	F140I	probably damaging	Het
Hyal2	T	A	9: 107,572,246	H400Q	probably benign	Het
Igfn1	A	G	1: 135,974,847	Y371H	probably damaging	Het
Iltifb	T	G	10: 118,290,151	*180C	probably null	Het
Kdm2b	T	C	5: 122,961,541	T118A	possibly damaging	Het
Lama5	A	T	2: 180,179,764		probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lmo7	C	T	14: 101,920,474		probably benign	Het
Lrrc37a	G	T	11: 103,497,631	P2323T	unknown	Het
Lrrc38	A	G	4: 143,350,518	Y117C	probably benign	Het
Myo1e	T	C	9: 70,383,999	V1024A	probably benign	Het
Myrfl	T	C	10: 116,776,732	N904S	possibly damaging	Het
Olfr1015	T	C	2: 85,786,093	V194A	possibly damaging	Het
Olfr103	T	A	17: 37,337,026	I69F	probably damaging	Het
Olfr1297	T	C	2: 111,621,345	H243R	probably damaging	Het
Pld4	A	T	12: 112,763,442	I53F	probably benign	Het
Plekhg4	T	A	8: 105,381,677	C1117*	probably null	Het
Prss39	G	A	1: 34,502,086	E224K	probably benign	Het
Psme1	G	T	14: 55,580,650	G149V	probably damaging	Het
Soat2	T	A	15: 102,153,138		probably null	Het
Stab2	C	T	10: 86,907,133		probably null	Het
Tcf7l2	A	G	19: 55,743,195	T127A	probably benign	Het
Tcp1	T	C	17: 12,923,204		probably benign	Het
Thbs4	G	A	13: 92,762,926		probably benign	Het
Tmf1	T	C	6: 97,173,300	D482G	probably damaging	Het
Trim66	G	T	7: 109,472,319	P591H	probably damaging	Het
Umodl1	T	C	17: 30,959,373	S108P	probably benign	Het
Unc79	T	G	12: 103,074,853	M715R	probably benign	Het
Usp34	C	A	11: 23,433,175		probably benign	Het
Utrn	T	G	10: 12,455,566		probably null	Het
Zfp830	T	C	11: 82,765,339		probably null	Het

Other mutations in Gabbr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Gabbr2	APN	4	46787600	missense	probably damaging	1.00
IGL00844:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL01584:Gabbr2	APN	4	46674524	missense	probably damaging	0.97
IGL01684:Gabbr2	APN	4	46736501	missense	probably benign
IGL01884:Gabbr2	APN	4	46875711	missense	probably damaging	1.00
IGL02073:Gabbr2	APN	4	46667547	missense	probably benign	0.00
IGL02376:Gabbr2	APN	4	46684300	missense	probably damaging	1.00
R0194:Gabbr2	UTSW	4	46787565	missense	possibly damaging	0.48
R0627:Gabbr2	UTSW	4	46681223	missense	possibly damaging	0.92
R0685:Gabbr2	UTSW	4	46787521	missense	possibly damaging	0.64
R0781:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R0882:Gabbr2	UTSW	4	46718904	missense	probably damaging	1.00
R0883:Gabbr2	UTSW	4	46677474	missense	probably benign	0.00
R1004:Gabbr2	UTSW	4	46677544	missense	possibly damaging	0.60
R1110:Gabbr2	UTSW	4	46718838	missense	probably damaging	1.00
R1368:Gabbr2	UTSW	4	46674464	missense	probably benign	0.31
R1557:Gabbr2	UTSW	4	46846436	missense	probably damaging	1.00
R1577:Gabbr2	UTSW	4	46684319	missense	probably benign	0.29
R1645:Gabbr2	UTSW	4	46664963	splice site	probably null
R1743:Gabbr2	UTSW	4	46677603	missense	possibly damaging	0.47
R1848:Gabbr2	UTSW	4	46739823	missense	probably benign	0.31
R1997:Gabbr2	UTSW	4	46787502	missense	probably damaging	1.00
R2009:Gabbr2	UTSW	4	46734119	missense	probably damaging	1.00
R4021:Gabbr2	UTSW	4	46846435	missense	probably damaging	1.00
R4719:Gabbr2	UTSW	4	46718797	missense	probably damaging	0.99
R4757:Gabbr2	UTSW	4	46875675	missense	probably damaging	0.98
R4798:Gabbr2	UTSW	4	46991139	missense	possibly damaging	0.92
R5086:Gabbr2	UTSW	4	46724342	missense	probably damaging	1.00
R5176:Gabbr2	UTSW	4	46681208	missense	probably damaging	0.99
R5451:Gabbr2	UTSW	4	46684294	missense	probably benign	0.15
R5510:Gabbr2	UTSW	4	46734113	missense	probably damaging	1.00
R5611:Gabbr2	UTSW	4	46804105	missense	probably damaging	0.98
R6049:Gabbr2	UTSW	4	46787641	missense	probably damaging	1.00
R6089:Gabbr2	UTSW	4	46846448	missense	probably damaging	1.00
R6118:Gabbr2	UTSW	4	46736459	missense	probably damaging	1.00
R6209:Gabbr2	UTSW	4	46804069	missense	probably damaging	1.00
R6212:Gabbr2	UTSW	4	46681189	missense	probably damaging	0.98
R6717:Gabbr2	UTSW	4	46787574	missense	possibly damaging	0.50
R7339:Gabbr2	UTSW	4	46846340	missense	probably benign	0.01
R7479:Gabbr2	UTSW	4	46681166	missense	probably damaging	0.98
R7695:Gabbr2	UTSW	4	46875687	missense	probably damaging	1.00
R7808:Gabbr2	UTSW	4	46875744	missense	possibly damaging	0.49
R7832:Gabbr2	UTSW	4	46734096	missense	probably benign	0.04
R7993:Gabbr2	UTSW	4	46736349	splice site	probably null
R7994:Gabbr2	UTSW	4	46736349	splice site	probably null
R8051:Gabbr2	UTSW	4	46736349	splice site	probably null
R8084:Gabbr2	UTSW	4	46736349	splice site	probably null
R9050:Gabbr2	UTSW	4	46798659	missense	probably benign	0.03
R9187:Gabbr2	UTSW	4	46674533	missense	probably damaging	1.00
R9622:Gabbr2	UTSW	4	46724283	critical splice donor site	probably null
R9655:Gabbr2	UTSW	4	46815684	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GAGAAGTCATTGCCATTCCTCTCCC -3'
(R):5'- CGTCAAATGCCTGCTTCATGTCTG -3'

Sequencing Primer
(F):5'- GACCGTCGTAGATAAGGCTC -3'
(R):5'- gtgtgtgggtttttttgttttttg -3'

Posted On

2013-11-18