Incidental Mutation 'R1078:Lrrc38'
ID85722
Institutional Source Beutler Lab
Gene Symbol Lrrc38
Ensembl Gene ENSMUSG00000028584
Gene Nameleucine rich repeat containing 38
Synonyms
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R1078 (G1)
Quality Score168
Status Validated
Chromosome4
Chromosomal Location143349757-143371032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143350518 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 117 (Y117C)
Ref Sequence ENSEMBL: ENSMUSP00000053597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052458]
Predicted Effect probably benign
Transcript: ENSMUST00000052458
AA Change: Y117C

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053597
Gene: ENSMUSG00000028584
AA Change: Y117C

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
LRRNT 31 64 2.82e-4 SMART
LRR 84 106 1.37e1 SMART
LRR 108 130 5.26e0 SMART
LRR 132 154 2.27e1 SMART
LRR 155 178 8.09e-1 SMART
LRRCT 190 244 8.63e-6 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Meta Mutation Damage Score 0.0781 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Lrrc38
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0281:Lrrc38 UTSW 4 143350409 missense probably damaging 0.99
R0545:Lrrc38 UTSW 4 143350758 missense probably benign 0.41
R1467:Lrrc38 UTSW 4 143369880 missense probably damaging 1.00
R1467:Lrrc38 UTSW 4 143369880 missense probably damaging 1.00
R1967:Lrrc38 UTSW 4 143369983 missense unknown
R2221:Lrrc38 UTSW 4 143369849 nonsense probably null
R2223:Lrrc38 UTSW 4 143369849 nonsense probably null
R4061:Lrrc38 UTSW 4 143350506 missense probably damaging 1.00
R4930:Lrrc38 UTSW 4 143369868 missense probably damaging 0.98
R5585:Lrrc38 UTSW 4 143350391 missense probably damaging 0.96
R6787:Lrrc38 UTSW 4 143369794 missense probably benign 0.18
R7046:Lrrc38 UTSW 4 143350169 start codon destroyed probably null
R7706:Lrrc38 UTSW 4 143350275 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAATTCTGCGCCCAGCACCTC -3'
(R):5'- TGTTGTCGTTGAGTTCCAGCACC -3'

Sequencing Primer
(F):5'- GCACTCTCATcgccccc -3'
(R):5'- TGAGTTCCAGCACCTGCAAG -3'
Posted On2013-11-18