Incidental Mutation 'R1078:9130230L23Rik'
ID85723
Institutional Source Beutler Lab
Gene Symbol 9130230L23Rik
Ensembl Gene ENSMUSG00000054598
Gene NameRIKEN cDNA 9130230L23 gene
Synonyms
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R1078 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location65979358-66004285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65988355 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 138 (T138A)
Ref Sequence ENSEMBL: ENSMUSP00000143918 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000067737
AA Change: T138A
Predicted Effect unknown
Transcript: ENSMUST00000165250
AA Change: T138A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175329
Predicted Effect unknown
Transcript: ENSMUST00000201351
AA Change: T138A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202773
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in 9130230L23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:9130230L23Rik APN 5 65989844 missense unknown
IGL02186:9130230L23Rik APN 5 65988468 missense unknown
R0400:9130230L23Rik UTSW 5 65990356 missense unknown
R1188:9130230L23Rik UTSW 5 65990398 missense unknown
R1867:9130230L23Rik UTSW 5 66000217 start codon destroyed probably null
R1868:9130230L23Rik UTSW 5 66000217 start codon destroyed probably null
R5903:9130230L23Rik UTSW 5 65988318 missense unknown
R5925:9130230L23Rik UTSW 5 65990392 nonsense probably null
R7318:9130230L23Rik UTSW 5 65988428 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCGTCATTCAAGAGACCCAGCAG -3'
(R):5'- AGAGTCACATGTCAGAGGCCCAAG -3'

Sequencing Primer
(F):5'- GGGTTTGCACTAATCAGACTTTAGC -3'
(R):5'- TGTCAGAGGCCCAAGATTTC -3'
Posted On2013-11-18