Incidental Mutation 'R1078:9130230L23Rik'
ID 85723
Institutional Source Beutler Lab
Gene Symbol 9130230L23Rik
Ensembl Gene ENSMUSG00000054598
Gene Name RIKEN cDNA 9130230L23 gene
Synonyms
MMRRC Submission 039164-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.210) question?
Stock # R1078 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 66145271-66161628 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 66145698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 138 (T138A)
Ref Sequence ENSEMBL: ENSMUSP00000143918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165250] [ENSMUST00000201351]
AlphaFold Q8CC80
Predicted Effect unknown
Transcript: ENSMUST00000067737
AA Change: T138A
Predicted Effect unknown
Transcript: ENSMUST00000165250
AA Change: T138A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175329
Predicted Effect unknown
Transcript: ENSMUST00000201351
AA Change: T138A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202773
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp T C 16: 56,474,444 (GRCm39) probably null Het
Alpk3 A T 7: 80,728,348 (GRCm39) M493L probably benign Het
Bace2 C T 16: 97,158,060 (GRCm39) A20V unknown Het
Bms1 T C 6: 118,382,182 (GRCm39) D452G probably benign Het
Ccdc187 T C 2: 26,184,389 (GRCm39) T3A probably damaging Het
Ctu2 T C 8: 123,208,238 (GRCm39) V95A possibly damaging Het
Cyp2a5 A G 7: 26,534,966 (GRCm39) K60E probably benign Het
Cyp4f13 T C 17: 33,144,542 (GRCm39) H318R probably damaging Het
Dlgap5 G A 14: 47,637,023 (GRCm39) T485M probably damaging Het
Dsp C T 13: 38,367,082 (GRCm39) probably benign Het
Ell2 T C 13: 75,894,538 (GRCm39) probably benign Het
Eml2 A T 7: 18,913,687 (GRCm39) Y168F probably benign Het
Entrep1 T A 19: 23,950,939 (GRCm39) R547S probably benign Het
Ep400 C T 5: 110,883,388 (GRCm39) probably benign Het
Ercc4 C A 16: 12,948,061 (GRCm39) A336D probably benign Het
Fat4 T C 3: 39,037,235 (GRCm39) L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 (GRCm39) R925H probably damaging Het
Gfi1b A T 2: 28,503,877 (GRCm39) W108R probably damaging Het
Gtse1 C T 15: 85,746,508 (GRCm39) P108L probably damaging Het
Hfm1 A T 5: 107,026,696 (GRCm39) F140I probably damaging Het
Hyal2 T A 9: 107,449,445 (GRCm39) H400Q probably benign Het
Igfn1 A G 1: 135,902,585 (GRCm39) Y371H probably damaging Het
Il22b T G 10: 118,126,056 (GRCm39) *180C probably null Het
Kdm2b T C 5: 123,099,604 (GRCm39) T118A possibly damaging Het
Lama5 A T 2: 179,821,557 (GRCm39) probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lmo7 C T 14: 102,157,910 (GRCm39) probably benign Het
Lrrc37a G T 11: 103,388,457 (GRCm39) P2323T unknown Het
Lrrc38 A G 4: 143,077,088 (GRCm39) Y117C probably benign Het
Myo1e T C 9: 70,291,281 (GRCm39) V1024A probably benign Het
Myrfl T C 10: 116,612,637 (GRCm39) N904S possibly damaging Het
Or12d13 T A 17: 37,647,917 (GRCm39) I69F probably damaging Het
Or4k47 T C 2: 111,451,690 (GRCm39) H243R probably damaging Het
Or9g4b T C 2: 85,616,437 (GRCm39) V194A possibly damaging Het
Pld4 A T 12: 112,729,876 (GRCm39) I53F probably benign Het
Plekhg4 T A 8: 106,108,309 (GRCm39) C1117* probably null Het
Prss39 G A 1: 34,541,167 (GRCm39) E224K probably benign Het
Psme1 G T 14: 55,818,107 (GRCm39) G149V probably damaging Het
Sanbr A C 11: 23,561,762 (GRCm39) I358S probably benign Het
Soat2 T A 15: 102,061,573 (GRCm39) probably null Het
Stab2 C T 10: 86,742,997 (GRCm39) probably null Het
Tcf7l2 A G 19: 55,731,627 (GRCm39) T127A probably benign Het
Tcp1 T C 17: 13,142,091 (GRCm39) probably benign Het
Thbs4 G A 13: 92,899,434 (GRCm39) probably benign Het
Tmf1 T C 6: 97,150,261 (GRCm39) D482G probably damaging Het
Trim66 G T 7: 109,071,526 (GRCm39) P591H probably damaging Het
Umodl1 T C 17: 31,178,347 (GRCm39) S108P probably benign Het
Unc79 T G 12: 103,041,112 (GRCm39) M715R probably benign Het
Usp34 C A 11: 23,383,175 (GRCm39) probably benign Het
Utrn T G 10: 12,331,310 (GRCm39) probably null Het
Zfp830 T C 11: 82,656,165 (GRCm39) probably null Het
Other mutations in 9130230L23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:9130230L23Rik APN 5 66,147,187 (GRCm39) missense unknown
IGL02186:9130230L23Rik APN 5 66,145,811 (GRCm39) missense unknown
R0400:9130230L23Rik UTSW 5 66,147,699 (GRCm39) missense unknown
R1188:9130230L23Rik UTSW 5 66,147,741 (GRCm39) missense unknown
R1867:9130230L23Rik UTSW 5 66,157,560 (GRCm39) start codon destroyed probably null
R1868:9130230L23Rik UTSW 5 66,157,560 (GRCm39) start codon destroyed probably null
R5903:9130230L23Rik UTSW 5 66,145,661 (GRCm39) missense unknown
R5925:9130230L23Rik UTSW 5 66,147,735 (GRCm39) nonsense probably null
R7318:9130230L23Rik UTSW 5 66,145,771 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGCGTCATTCAAGAGACCCAGCAG -3'
(R):5'- AGAGTCACATGTCAGAGGCCCAAG -3'

Sequencing Primer
(F):5'- GGGTTTGCACTAATCAGACTTTAGC -3'
(R):5'- TGTCAGAGGCCCAAGATTTC -3'
Posted On 2013-11-18