Incidental Mutation 'R1078:Kdm2b'
ID 85726
Institutional Source Beutler Lab
Gene Symbol Kdm2b
Ensembl Gene ENSMUSG00000029475
Gene Name lysine (K)-specific demethylase 2B
Synonyms Jhdm1b, Fbxl10, Cxxc2
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1078 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 122870665-122989823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122961541 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 118 (T118A)
Ref Sequence ENSEMBL: ENSMUSP00000038229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046073] [ENSMUST00000086200] [ENSMUST00000118027] [ENSMUST00000121739] [ENSMUST00000127403] [ENSMUST00000156474]
AlphaFold Q6P1G2
Predicted Effect possibly damaging
Transcript: ENSMUST00000046073
AA Change: T118A

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038229
Gene: ENSMUSG00000029475
AA Change: T118A

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 1e-17 PDB
Pfam:zf-CXXC 578 624 3e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 792 823 N/A INTRINSIC
low complexity region 903 913 N/A INTRINSIC
low complexity region 990 1006 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
FBOX 1038 1078 1.69e-2 SMART
LRR 1121 1143 1.31e2 SMART
LRR 1145 1170 2.9e2 SMART
LRR 1185 1209 2.04e2 SMART
LRR 1210 1235 1.1e1 SMART
LRR 1265 1290 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086200
AA Change: T112A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000083376
Gene: ENSMUSG00000029475
AA Change: T112A

DomainStartEndE-ValueType
Blast:JmjC 17 95 4e-41 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 540 1e-17 PDB
Pfam:zf-CXXC 572 618 2.1e-17 PFAM
PHD 628 690 8.58e-4 SMART
low complexity region 786 817 N/A INTRINSIC
low complexity region 897 907 N/A INTRINSIC
low complexity region 984 1000 N/A INTRINSIC
low complexity region 1012 1026 N/A INTRINSIC
FBOX 1032 1072 1.69e-2 SMART
LRR 1115 1137 1.31e2 SMART
LRR 1139 1164 2.9e2 SMART
LRR 1179 1203 2.04e2 SMART
LRR 1204 1229 1.1e1 SMART
LRR 1259 1284 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118027
AA Change: T118A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114052
Gene: ENSMUSG00000029475
AA Change: T118A

DomainStartEndE-ValueType
Blast:JmjC 23 101 4e-41 BLAST
JmjC 147 315 3.61e-41 SMART
low complexity region 380 401 N/A INTRINSIC
low complexity region 406 424 N/A INTRINSIC
PDB:2YU2|A 472 546 9e-18 PDB
Pfam:zf-CXXC 578 624 2.1e-17 PFAM
PHD 634 696 8.58e-4 SMART
low complexity region 865 875 N/A INTRINSIC
low complexity region 952 968 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
FBOX 1000 1040 1.69e-2 SMART
LRR 1083 1105 1.31e2 SMART
LRR 1107 1132 2.9e2 SMART
LRR 1147 1171 2.04e2 SMART
LRR 1172 1197 1.1e1 SMART
LRR 1227 1252 3.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121739
AA Change: T63A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114049
Gene: ENSMUSG00000029475
AA Change: T63A

DomainStartEndE-ValueType
Blast:JmjC 1 46 2e-19 BLAST
JmjC 92 260 3.61e-41 SMART
low complexity region 325 346 N/A INTRINSIC
low complexity region 351 369 N/A INTRINSIC
PDB:2YU2|A 417 491 1e-17 PDB
Pfam:zf-CXXC 523 569 5.4e-17 PFAM
PHD 579 641 8.58e-4 SMART
low complexity region 737 768 N/A INTRINSIC
low complexity region 848 858 N/A INTRINSIC
low complexity region 935 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
FBOX 983 1023 1.69e-2 SMART
LRR 1066 1088 1.31e2 SMART
LRR 1090 1115 2.9e2 SMART
LRR 1130 1154 2.04e2 SMART
LRR 1155 1180 1.1e1 SMART
LRR 1210 1235 3.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123479
Predicted Effect silent
Transcript: ENSMUST00000127403
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150543
Predicted Effect probably benign
Transcript: ENSMUST00000156474
AA Change: T112A

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118488
Gene: ENSMUSG00000029475
AA Change: T112A

DomainStartEndE-ValueType
Blast:JmjC 17 95 3e-42 BLAST
JmjC 141 309 3.61e-41 SMART
low complexity region 374 395 N/A INTRINSIC
low complexity region 400 418 N/A INTRINSIC
PDB:2YU2|A 466 512 1e-8 PDB
Meta Mutation Damage Score 0.0831 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: The protein encoded by this gene is a H3K36-specific histone demethylase, which contains an N-terminal jumonji C domain, a CxxC zinc finger domain, a plant homeodomain finger, an F-box, and eight leucine-rich repeats. Amongst its demonstrated functions, this protein plays roles in the suppression of premature cellular senescence, leukemia maintenance and development, maintenance of mouse embryonic stem cell pluripotency, and induced pluripotent stem cell generation. Mice homozygous for a targeted deletion of the zinc finger domain display embryonic lethality with development ceasing at approximately 7 to 8 days post coitum, demonstrating an essential role in early development. A pseudogene of this gene is found on chromosome 4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a targeted allele that does not express the long form protein exhibit exencephaly, fetal and postnatal lethality, coloboma, curly tail, oligozoospermia, increased apoptosis, and increased neuronal precursor proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Kdm2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Kdm2b APN 5 122961567 missense probably damaging 1.00
IGL02061:Kdm2b APN 5 122883341 missense probably damaging 1.00
IGL02142:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02143:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02147:Kdm2b APN 5 122947835 missense probably damaging 0.99
IGL02294:Kdm2b APN 5 122961474 missense probably damaging 1.00
IGL02309:Kdm2b APN 5 122947820 missense probably damaging 0.99
IGL03039:Kdm2b APN 5 122881671 missense probably benign 0.06
IGL03134:Kdm2b UTSW 5 122932674 missense probably damaging 1.00
PIT4520001:Kdm2b UTSW 5 122941047 missense probably damaging 1.00
R0008:Kdm2b UTSW 5 122881743 missense probably benign 0.08
R0592:Kdm2b UTSW 5 122961134 splice site probably benign
R0894:Kdm2b UTSW 5 122984460 critical splice donor site probably null
R1387:Kdm2b UTSW 5 122880268 missense probably damaging 1.00
R1441:Kdm2b UTSW 5 122932880 missense probably benign 0.25
R1550:Kdm2b UTSW 5 122881057 missense probably damaging 1.00
R1795:Kdm2b UTSW 5 122984460 critical splice donor site probably null
R2060:Kdm2b UTSW 5 122883365 missense probably damaging 1.00
R2161:Kdm2b UTSW 5 122880699 missense probably damaging 1.00
R2259:Kdm2b UTSW 5 122882416 missense probably damaging 1.00
R3843:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R3844:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R3859:Kdm2b UTSW 5 122880227 missense probably damaging 1.00
R4506:Kdm2b UTSW 5 122888625 missense possibly damaging 0.58
R4680:Kdm2b UTSW 5 122934786 missense probably damaging 0.99
R4786:Kdm2b UTSW 5 122880854 critical splice acceptor site probably null
R4894:Kdm2b UTSW 5 122940967 nonsense probably null
R5265:Kdm2b UTSW 5 122878588 missense probably damaging 1.00
R5522:Kdm2b UTSW 5 122949162 missense probably damaging 1.00
R5746:Kdm2b UTSW 5 122879364 missense probably damaging 1.00
R5813:Kdm2b UTSW 5 122871868 missense probably benign 0.37
R5920:Kdm2b UTSW 5 122880296 missense probably damaging 1.00
R5961:Kdm2b UTSW 5 122932661 missense probably benign 0.37
R6029:Kdm2b UTSW 5 122879587 missense probably damaging 1.00
R6280:Kdm2b UTSW 5 122878624 missense probably damaging 1.00
R6303:Kdm2b UTSW 5 122881744 missense probably benign 0.34
R6304:Kdm2b UTSW 5 122881744 missense probably benign 0.34
R6383:Kdm2b UTSW 5 122934778 missense probably damaging 1.00
R6432:Kdm2b UTSW 5 122880191 missense probably damaging 1.00
R6513:Kdm2b UTSW 5 122880239 missense probably damaging 0.99
R6526:Kdm2b UTSW 5 122961469 missense probably damaging 1.00
R7213:Kdm2b UTSW 5 122921469 missense probably damaging 0.99
R7226:Kdm2b UTSW 5 122921449 missense possibly damaging 0.60
R7292:Kdm2b UTSW 5 122880791 missense probably damaging 0.98
R7893:Kdm2b UTSW 5 122947739 missense probably benign 0.12
R8021:Kdm2b UTSW 5 122932919 missense probably damaging 0.99
R8038:Kdm2b UTSW 5 122960895 intron probably benign
R8162:Kdm2b UTSW 5 122934793 missense probably damaging 0.98
R8397:Kdm2b UTSW 5 122880516 missense probably benign 0.03
R8411:Kdm2b UTSW 5 122880176 missense probably damaging 1.00
R8899:Kdm2b UTSW 5 122987788 nonsense probably null
R8997:Kdm2b UTSW 5 122880173 missense probably null 0.99
R9192:Kdm2b UTSW 5 122932616 missense probably benign 0.05
R9238:Kdm2b UTSW 5 122871826 missense probably damaging 0.98
Z1177:Kdm2b UTSW 5 122880797 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCCGTCATAAGCACACGGAGC -3'
(R):5'- ACAGTCACTGGCAGACTGGGAATAG -3'

Sequencing Primer
(F):5'- ATACCCTAAGGGATCAGTCTCGG -3'
(R):5'- TAGAGGTGACGCGAGTTGG -3'
Posted On 2013-11-18