Incidental Mutation 'R1078:Bms1'
ID85728
Institutional Source Beutler Lab
Gene Symbol Bms1
Ensembl Gene ENSMUSG00000030138
Gene NameBMS1, ribosome biogenesis factor
SynonymsBms1l
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1078 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location118383381-118419474 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118405221 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 452 (D452G)
Ref Sequence ENSEMBL: ENSMUSP00000032237 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032237]
Predicted Effect probably benign
Transcript: ENSMUST00000032237
AA Change: D452G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032237
Gene: ENSMUSG00000030138
AA Change: D452G

DomainStartEndE-ValueType
SCOP:d1f5na2 78 187 2e-5 SMART
low complexity region 190 205 N/A INTRINSIC
AARP2CN 231 317 2.15e-42 SMART
low complexity region 436 460 N/A INTRINSIC
low complexity region 462 481 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
low complexity region 518 537 N/A INTRINSIC
low complexity region 590 613 N/A INTRINSIC
low complexity region 642 661 N/A INTRINSIC
Blast:AAA 663 740 9e-20 BLAST
DUF663 816 1108 6.7e-173 SMART
coiled coil region 1223 1257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205207
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene likely encodes a ribosome assembly protein. A similar protein in yeast functions in 35S-rRNA processing, which includes a series of cleavage steps critical for formation of 40S ribosomes. Related pseudogenes exist on chromosomes 2, 9, 10, 15, 16, and 22.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Bms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Bms1 APN 6 118404583 missense probably benign 0.01
IGL00763:Bms1 APN 6 118418402 splice site probably benign
IGL00839:Bms1 APN 6 118405291 missense probably benign 0.30
IGL02005:Bms1 APN 6 118404585 missense probably damaging 1.00
IGL02271:Bms1 APN 6 118389329 missense probably benign 0.10
IGL02403:Bms1 APN 6 118405224 missense possibly damaging 0.89
IGL02474:Bms1 APN 6 118416519 missense probably benign 0.00
IGL03230:Bms1 APN 6 118418561 missense possibly damaging 0.88
IGL03277:Bms1 APN 6 118405122 missense probably benign
PIT4508001:Bms1 UTSW 6 118383806 missense probably benign 0.03
R0028:Bms1 UTSW 6 118416519 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0056:Bms1 UTSW 6 118405229 missense probably benign 0.00
R0276:Bms1 UTSW 6 118408134 missense possibly damaging 0.87
R0295:Bms1 UTSW 6 118389337 missense probably benign 0.04
R0360:Bms1 UTSW 6 118405290 missense probably benign 0.13
R0556:Bms1 UTSW 6 118413179 missense probably damaging 1.00
R1583:Bms1 UTSW 6 118389389 splice site probably benign
R1815:Bms1 UTSW 6 118383781 missense probably damaging 1.00
R1957:Bms1 UTSW 6 118392978 missense probably damaging 0.98
R2045:Bms1 UTSW 6 118392627 missense probably damaging 1.00
R2511:Bms1 UTSW 6 118391153 splice site probably null
R4293:Bms1 UTSW 6 118405347 splice site probably null
R4296:Bms1 UTSW 6 118404999 missense probably damaging 0.96
R4467:Bms1 UTSW 6 118383847 missense probably damaging 0.99
R4688:Bms1 UTSW 6 118392706 missense probably damaging 1.00
R4718:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R5015:Bms1 UTSW 6 118404263 nonsense probably null
R5327:Bms1 UTSW 6 118405218 missense possibly damaging 0.53
R5489:Bms1 UTSW 6 118413745 missense possibly damaging 0.64
R5511:Bms1 UTSW 6 118388887 missense possibly damaging 0.85
R5636:Bms1 UTSW 6 118388825 missense probably benign 0.00
R5815:Bms1 UTSW 6 118404279 missense probably damaging 1.00
R6245:Bms1 UTSW 6 118396836 missense probably damaging 0.96
R6299:Bms1 UTSW 6 118418515 missense probably damaging 0.98
R6389:Bms1 UTSW 6 118403235 missense possibly damaging 0.91
R6838:Bms1 UTSW 6 118416494 missense probably benign 0.00
R7129:Bms1 UTSW 6 118403161 nonsense probably null
R7414:Bms1 UTSW 6 118383745 missense possibly damaging 0.93
R7811:Bms1 UTSW 6 118403138 missense probably damaging 0.99
R7883:Bms1 UTSW 6 118388774 missense probably benign 0.04
R7966:Bms1 UTSW 6 118388774 missense probably benign 0.04
R8046:Bms1 UTSW 6 118408144 missense probably benign
R8068:Bms1 UTSW 6 118413750 missense probably damaging 1.00
R8098:Bms1 UTSW 6 118384258 missense probably damaging 0.98
X0067:Bms1 UTSW 6 118404834 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TTCTCCAACAGAGCCGCATTCC -3'
(R):5'- TGCATAGTGGACTGGCATTAGCTTC -3'

Sequencing Primer
(F):5'- TCAAGGTCATCATCGCTATCAG -3'
(R):5'- GGCATTAGCTTCTTACTGCACAG -3'
Posted On2013-11-18