Mutagenetix > Incidental Mutations

Incidental Mutation 'R1078:Trim66'

85732

Institutional Source

Beutler Lab

Gene Symbol

Trim66

Ensembl Gene

ENSMUSG00000031026

Gene Name

tripartite motif-containing 66

Synonyms

Tif1d, D7H11orf29

MMRRC Submission

039164-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.155) question?

Stock #

R1078 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109449006-109508134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 109472319 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Histidine at position 591 (P591H)

Ref Sequence

ENSEMBL: ENSMUSP00000102350 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]

AlphaFold

Q924W6

Predicted Effect

probably damaging
Transcript: ENSMUST00000033339
AA Change: P591H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: P591H

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106739
AA Change: P591H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: P591H

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106741
AA Change: P693H

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: P693H

Domain	Start	End	E-Value	Type
RING	28	78	2.38e-2	SMART
BBOX	102	140	1.48e0	SMART
PHD	106	171	7.77e0	SMART
RING	107	170	4.38e0	SMART
BBOX	162	203	4.21e-3	SMART
BBC	210	336	1.61e-39	SMART
low complexity region	420	435	N/A	INTRINSIC
low complexity region	554	588	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
PHD	1100	1143	4.09e-10	SMART
BROMO	1171	1277	8.22e-27	SMART
low complexity region	1287	1301	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137704

Meta Mutation Damage Score

0.0957

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.4%
20x: 94.4%

Validation Efficiency

96% (53/55)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,611,762	I358S	probably benign	Het
9130230L23Rik	T	C	5: 65,988,355	T138A	unknown	Het
Abi3bp	T	C	16: 56,654,081		probably null	Het
Alpk3	A	T	7: 81,078,600	M493L	probably benign	Het
Bace2	C	T	16: 97,356,860	A20V	unknown	Het
Bms1	T	C	6: 118,405,221	D452G	probably benign	Het
Ccdc187	T	C	2: 26,294,377	T3A	probably damaging	Het
Ctu2	T	C	8: 122,481,499	V95A	possibly damaging	Het
Cyp2a5	A	G	7: 26,835,541	K60E	probably benign	Het
Cyp4f13	T	C	17: 32,925,568	H318R	probably damaging	Het
Dlgap5	G	A	14: 47,399,566	T485M	probably damaging	Het
Dsp	C	T	13: 38,183,106		probably benign	Het
Ell2	T	C	13: 75,746,419		probably benign	Het
Eml2	A	T	7: 19,179,762	Y168F	probably benign	Het
Ep400	C	T	5: 110,735,522		probably benign	Het
Ercc4	C	A	16: 13,130,197	A336D	probably benign	Het
Fam189a2	T	A	19: 23,973,575	R547S	probably benign	Het
Fat4	T	C	3: 38,983,086	L3629S	probably benign	Het
Gabbr2	C	T	4: 46,664,833	R925H	probably damaging	Het
Gfi1b	A	T	2: 28,613,865	W108R	probably damaging	Het
Gtse1	C	T	15: 85,862,307	P108L	probably damaging	Het
Hfm1	A	T	5: 106,878,830	F140I	probably damaging	Het
Hyal2	T	A	9: 107,572,246	H400Q	probably benign	Het
Igfn1	A	G	1: 135,974,847	Y371H	probably damaging	Het
Iltifb	T	G	10: 118,290,151	*180C	probably null	Het
Kdm2b	T	C	5: 122,961,541	T118A	possibly damaging	Het
Lama5	A	T	2: 180,179,764		probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lmo7	C	T	14: 101,920,474		probably benign	Het
Lrrc37a	G	T	11: 103,497,631	P2323T	unknown	Het
Lrrc38	A	G	4: 143,350,518	Y117C	probably benign	Het
Myo1e	T	C	9: 70,383,999	V1024A	probably benign	Het
Myrfl	T	C	10: 116,776,732	N904S	possibly damaging	Het
Olfr1015	T	C	2: 85,786,093	V194A	possibly damaging	Het
Olfr103	T	A	17: 37,337,026	I69F	probably damaging	Het
Olfr1297	T	C	2: 111,621,345	H243R	probably damaging	Het
Pld4	A	T	12: 112,763,442	I53F	probably benign	Het
Plekhg4	T	A	8: 105,381,677	C1117*	probably null	Het
Prss39	G	A	1: 34,502,086	E224K	probably benign	Het
Psme1	G	T	14: 55,580,650	G149V	probably damaging	Het
Soat2	T	A	15: 102,153,138		probably null	Het
Stab2	C	T	10: 86,907,133		probably null	Het
Tcf7l2	A	G	19: 55,743,195	T127A	probably benign	Het
Tcp1	T	C	17: 12,923,204		probably benign	Het
Thbs4	G	A	13: 92,762,926		probably benign	Het
Tmf1	T	C	6: 97,173,300	D482G	probably damaging	Het
Umodl1	T	C	17: 30,959,373	S108P	probably benign	Het
Unc79	T	G	12: 103,074,853	M715R	probably benign	Het
Usp34	C	A	11: 23,433,175		probably benign	Het
Utrn	T	G	10: 12,455,566		probably null	Het
Zfp830	T	C	11: 82,765,339		probably null	Het

Other mutations in Trim66

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01539:Trim66	APN	7	109455066	missense	probably benign	0.02
IGL01758:Trim66	APN	7	109486045	critical splice donor site	probably null
IGL01982:Trim66	APN	7	109458763	missense	probably benign	0.00
IGL01983:Trim66	APN	7	109458251	nonsense	probably null
IGL02149:Trim66	APN	7	109460902	missense	possibly damaging	0.66
IGL02392:Trim66	APN	7	109460274	missense	probably benign	0.01
IGL02483:Trim66	APN	7	109477630	splice site	probably benign
IGL02832:Trim66	APN	7	109460497	missense	probably damaging	1.00
IGL02945:Trim66	APN	7	109460176	nonsense	probably null
IGL03085:Trim66	APN	7	109458745	missense	probably benign	0.17
PIT1430001:Trim66	UTSW	7	109475247	missense	probably damaging	0.99
R0326:Trim66	UTSW	7	109460172	missense	probably benign	0.00
R0358:Trim66	UTSW	7	109460176	nonsense	probably null
R0401:Trim66	UTSW	7	109475264	missense	probably damaging	0.98
R0470:Trim66	UTSW	7	109457542	splice site	probably benign
R0568:Trim66	UTSW	7	109460695	missense	probably benign	0.00
R0669:Trim66	UTSW	7	109454992	intron	probably benign
R0980:Trim66	UTSW	7	109455670	missense	probably damaging	1.00
R1015:Trim66	UTSW	7	109455233	missense	probably damaging	1.00
R1099:Trim66	UTSW	7	109475454	missense	probably benign	0.34
R1181:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R1497:Trim66	UTSW	7	109484619	missense	probably benign	0.00
R1583:Trim66	UTSW	7	109455080	missense	probably damaging	1.00
R1843:Trim66	UTSW	7	109475839	missense	probably damaging	0.99
R1998:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R2016:Trim66	UTSW	7	109472232	critical splice donor site	probably null
R2143:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2144:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2145:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R3945:Trim66	UTSW	7	109472268	missense	possibly damaging	0.94
R4012:Trim66	UTSW	7	109458131	missense	probably damaging	0.98
R4464:Trim66	UTSW	7	109477690	missense	possibly damaging	0.51
R4473:Trim66	UTSW	7	109481995	missense	probably damaging	1.00
R4729:Trim66	UTSW	7	109456060	critical splice donor site	probably null
R4730:Trim66	UTSW	7	109483069	missense	probably damaging	1.00
R4775:Trim66	UTSW	7	109457589	nonsense	probably null
R4819:Trim66	UTSW	7	109457586	missense	probably damaging	1.00
R5269:Trim66	UTSW	7	109457590	missense	probably benign	0.00
R5557:Trim66	UTSW	7	109483737	missense	probably benign	0.06
R5832:Trim66	UTSW	7	109455202	missense	probably damaging	1.00
R6220:Trim66	UTSW	7	109483093	missense	probably damaging	0.97
R6243:Trim66	UTSW	7	109460274	missense	probably benign	0.01
R6374:Trim66	UTSW	7	109486062	missense	probably benign
R6450:Trim66	UTSW	7	109460738	missense	probably benign	0.09
R6543:Trim66	UTSW	7	109475879	missense	probably benign	0.01
R6788:Trim66	UTSW	7	109477754	missense	probably damaging	1.00
R6842:Trim66	UTSW	7	109460776	missense	probably benign	0.00
R7169:Trim66	UTSW	7	109455121	missense	probably benign	0.25
R7257:Trim66	UTSW	7	109460244	missense	probably damaging	1.00
R7328:Trim66	UTSW	7	109457751	missense	probably damaging	0.99
R7616:Trim66	UTSW	7	109483749	missense	probably damaging	0.99
R8423:Trim66	UTSW	7	109475392	missense	possibly damaging	0.77
R8855:Trim66	UTSW	7	109481981	missense	probably damaging	1.00
R9130:Trim66	UTSW	7	109477689	missense	possibly damaging	0.90
R9137:Trim66	UTSW	7	109475123	missense	probably damaging	0.99
RF013:Trim66	UTSW	7	109460753	missense	probably damaging	0.99
RF024:Trim66	UTSW	7	109460740	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GGGGAAAGACCATCATTGCTTCATTGC -3'
(R):5'- TCATGGTGTGTAAACAGCTACAAGGGG -3'

Sequencing Primer
(F):5'- CTTCATTGCTGACTTAGGGAAAAGG -3'
(R):5'- GCTACAAGGGGCAGGGC -3'

Posted On

2013-11-18