Incidental Mutation 'R1078:Trim66'
ID 85732
Institutional Source Beutler Lab
Gene Symbol Trim66
Ensembl Gene ENSMUSG00000031026
Gene Name tripartite motif-containing 66
Synonyms Tif1d, D7H11orf29
MMRRC Submission 039164-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.155) question?
Stock # R1078 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 109048213-109107341 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 109071526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Histidine at position 591 (P591H)
Ref Sequence ENSEMBL: ENSMUSP00000102350 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]
AlphaFold Q924W6
Predicted Effect probably damaging
Transcript: ENSMUST00000033339
AA Change: P591H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: P591H

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106739
AA Change: P591H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: P591H

DomainStartEndE-ValueType
PHD 4 69 7.77e0 SMART
BBC 108 234 1.61e-39 SMART
low complexity region 318 333 N/A INTRINSIC
low complexity region 452 486 N/A INTRINSIC
low complexity region 517 530 N/A INTRINSIC
low complexity region 568 581 N/A INTRINSIC
PHD 998 1041 4.09e-10 SMART
BROMO 1069 1175 8.22e-27 SMART
low complexity region 1185 1199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106741
AA Change: P693H

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: P693H

DomainStartEndE-ValueType
RING 28 78 2.38e-2 SMART
BBOX 102 140 1.48e0 SMART
PHD 106 171 7.77e0 SMART
RING 107 170 4.38e0 SMART
BBOX 162 203 4.21e-3 SMART
BBC 210 336 1.61e-39 SMART
low complexity region 420 435 N/A INTRINSIC
low complexity region 554 588 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 670 683 N/A INTRINSIC
PHD 1100 1143 4.09e-10 SMART
BROMO 1171 1277 8.22e-27 SMART
low complexity region 1287 1301 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137704
Meta Mutation Damage Score 0.0957 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 66,145,698 (GRCm39) T138A unknown Het
Abi3bp T C 16: 56,474,444 (GRCm39) probably null Het
Alpk3 A T 7: 80,728,348 (GRCm39) M493L probably benign Het
Bace2 C T 16: 97,158,060 (GRCm39) A20V unknown Het
Bms1 T C 6: 118,382,182 (GRCm39) D452G probably benign Het
Ccdc187 T C 2: 26,184,389 (GRCm39) T3A probably damaging Het
Ctu2 T C 8: 123,208,238 (GRCm39) V95A possibly damaging Het
Cyp2a5 A G 7: 26,534,966 (GRCm39) K60E probably benign Het
Cyp4f13 T C 17: 33,144,542 (GRCm39) H318R probably damaging Het
Dlgap5 G A 14: 47,637,023 (GRCm39) T485M probably damaging Het
Dsp C T 13: 38,367,082 (GRCm39) probably benign Het
Ell2 T C 13: 75,894,538 (GRCm39) probably benign Het
Eml2 A T 7: 18,913,687 (GRCm39) Y168F probably benign Het
Entrep1 T A 19: 23,950,939 (GRCm39) R547S probably benign Het
Ep400 C T 5: 110,883,388 (GRCm39) probably benign Het
Ercc4 C A 16: 12,948,061 (GRCm39) A336D probably benign Het
Fat4 T C 3: 39,037,235 (GRCm39) L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 (GRCm39) R925H probably damaging Het
Gfi1b A T 2: 28,503,877 (GRCm39) W108R probably damaging Het
Gtse1 C T 15: 85,746,508 (GRCm39) P108L probably damaging Het
Hfm1 A T 5: 107,026,696 (GRCm39) F140I probably damaging Het
Hyal2 T A 9: 107,449,445 (GRCm39) H400Q probably benign Het
Igfn1 A G 1: 135,902,585 (GRCm39) Y371H probably damaging Het
Il22b T G 10: 118,126,056 (GRCm39) *180C probably null Het
Kdm2b T C 5: 123,099,604 (GRCm39) T118A possibly damaging Het
Lama5 A T 2: 179,821,557 (GRCm39) probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lmo7 C T 14: 102,157,910 (GRCm39) probably benign Het
Lrrc37a G T 11: 103,388,457 (GRCm39) P2323T unknown Het
Lrrc38 A G 4: 143,077,088 (GRCm39) Y117C probably benign Het
Myo1e T C 9: 70,291,281 (GRCm39) V1024A probably benign Het
Myrfl T C 10: 116,612,637 (GRCm39) N904S possibly damaging Het
Or12d13 T A 17: 37,647,917 (GRCm39) I69F probably damaging Het
Or4k47 T C 2: 111,451,690 (GRCm39) H243R probably damaging Het
Or9g4b T C 2: 85,616,437 (GRCm39) V194A possibly damaging Het
Pld4 A T 12: 112,729,876 (GRCm39) I53F probably benign Het
Plekhg4 T A 8: 106,108,309 (GRCm39) C1117* probably null Het
Prss39 G A 1: 34,541,167 (GRCm39) E224K probably benign Het
Psme1 G T 14: 55,818,107 (GRCm39) G149V probably damaging Het
Sanbr A C 11: 23,561,762 (GRCm39) I358S probably benign Het
Soat2 T A 15: 102,061,573 (GRCm39) probably null Het
Stab2 C T 10: 86,742,997 (GRCm39) probably null Het
Tcf7l2 A G 19: 55,731,627 (GRCm39) T127A probably benign Het
Tcp1 T C 17: 13,142,091 (GRCm39) probably benign Het
Thbs4 G A 13: 92,899,434 (GRCm39) probably benign Het
Tmf1 T C 6: 97,150,261 (GRCm39) D482G probably damaging Het
Umodl1 T C 17: 31,178,347 (GRCm39) S108P probably benign Het
Unc79 T G 12: 103,041,112 (GRCm39) M715R probably benign Het
Usp34 C A 11: 23,383,175 (GRCm39) probably benign Het
Utrn T G 10: 12,331,310 (GRCm39) probably null Het
Zfp830 T C 11: 82,656,165 (GRCm39) probably null Het
Other mutations in Trim66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Trim66 APN 7 109,054,273 (GRCm39) missense probably benign 0.02
IGL01758:Trim66 APN 7 109,085,252 (GRCm39) critical splice donor site probably null
IGL01982:Trim66 APN 7 109,057,970 (GRCm39) missense probably benign 0.00
IGL01983:Trim66 APN 7 109,057,458 (GRCm39) nonsense probably null
IGL02149:Trim66 APN 7 109,060,109 (GRCm39) missense possibly damaging 0.66
IGL02392:Trim66 APN 7 109,059,481 (GRCm39) missense probably benign 0.01
IGL02483:Trim66 APN 7 109,076,837 (GRCm39) splice site probably benign
IGL02832:Trim66 APN 7 109,059,704 (GRCm39) missense probably damaging 1.00
IGL02945:Trim66 APN 7 109,059,383 (GRCm39) nonsense probably null
IGL03085:Trim66 APN 7 109,057,952 (GRCm39) missense probably benign 0.17
PIT1430001:Trim66 UTSW 7 109,074,454 (GRCm39) missense probably damaging 0.99
R0326:Trim66 UTSW 7 109,059,379 (GRCm39) missense probably benign 0.00
R0358:Trim66 UTSW 7 109,059,383 (GRCm39) nonsense probably null
R0401:Trim66 UTSW 7 109,074,471 (GRCm39) missense probably damaging 0.98
R0470:Trim66 UTSW 7 109,056,749 (GRCm39) splice site probably benign
R0568:Trim66 UTSW 7 109,059,902 (GRCm39) missense probably benign 0.00
R0669:Trim66 UTSW 7 109,054,199 (GRCm39) intron probably benign
R0980:Trim66 UTSW 7 109,054,877 (GRCm39) missense probably damaging 1.00
R1015:Trim66 UTSW 7 109,054,440 (GRCm39) missense probably damaging 1.00
R1099:Trim66 UTSW 7 109,074,661 (GRCm39) missense probably benign 0.34
R1181:Trim66 UTSW 7 109,083,784 (GRCm39) critical splice donor site probably null
R1497:Trim66 UTSW 7 109,083,826 (GRCm39) missense probably benign 0.00
R1583:Trim66 UTSW 7 109,054,287 (GRCm39) missense probably damaging 1.00
R1843:Trim66 UTSW 7 109,075,046 (GRCm39) missense probably damaging 0.99
R1998:Trim66 UTSW 7 109,083,784 (GRCm39) critical splice donor site probably null
R2016:Trim66 UTSW 7 109,071,439 (GRCm39) critical splice donor site probably null
R2143:Trim66 UTSW 7 109,074,320 (GRCm39) missense probably damaging 0.98
R2144:Trim66 UTSW 7 109,074,320 (GRCm39) missense probably damaging 0.98
R2145:Trim66 UTSW 7 109,074,320 (GRCm39) missense probably damaging 0.98
R3945:Trim66 UTSW 7 109,071,475 (GRCm39) missense possibly damaging 0.94
R4012:Trim66 UTSW 7 109,057,338 (GRCm39) missense probably damaging 0.98
R4464:Trim66 UTSW 7 109,076,897 (GRCm39) missense possibly damaging 0.51
R4473:Trim66 UTSW 7 109,081,202 (GRCm39) missense probably damaging 1.00
R4729:Trim66 UTSW 7 109,055,267 (GRCm39) critical splice donor site probably null
R4730:Trim66 UTSW 7 109,082,276 (GRCm39) missense probably damaging 1.00
R4775:Trim66 UTSW 7 109,056,796 (GRCm39) nonsense probably null
R4819:Trim66 UTSW 7 109,056,793 (GRCm39) missense probably damaging 1.00
R5269:Trim66 UTSW 7 109,056,797 (GRCm39) missense probably benign 0.00
R5557:Trim66 UTSW 7 109,082,944 (GRCm39) missense probably benign 0.06
R5832:Trim66 UTSW 7 109,054,409 (GRCm39) missense probably damaging 1.00
R6220:Trim66 UTSW 7 109,082,300 (GRCm39) missense probably damaging 0.97
R6243:Trim66 UTSW 7 109,059,481 (GRCm39) missense probably benign 0.01
R6374:Trim66 UTSW 7 109,085,269 (GRCm39) missense probably benign
R6450:Trim66 UTSW 7 109,059,945 (GRCm39) missense probably benign 0.09
R6543:Trim66 UTSW 7 109,075,086 (GRCm39) missense probably benign 0.01
R6788:Trim66 UTSW 7 109,076,961 (GRCm39) missense probably damaging 1.00
R6842:Trim66 UTSW 7 109,059,983 (GRCm39) missense probably benign 0.00
R7169:Trim66 UTSW 7 109,054,328 (GRCm39) missense probably benign 0.25
R7257:Trim66 UTSW 7 109,059,451 (GRCm39) missense probably damaging 1.00
R7328:Trim66 UTSW 7 109,056,958 (GRCm39) missense probably damaging 0.99
R7616:Trim66 UTSW 7 109,082,956 (GRCm39) missense probably damaging 0.99
R8423:Trim66 UTSW 7 109,074,599 (GRCm39) missense possibly damaging 0.77
R8855:Trim66 UTSW 7 109,081,188 (GRCm39) missense probably damaging 1.00
R9130:Trim66 UTSW 7 109,076,896 (GRCm39) missense possibly damaging 0.90
R9137:Trim66 UTSW 7 109,074,330 (GRCm39) missense probably damaging 0.99
R9640:Trim66 UTSW 7 109,074,825 (GRCm39) missense probably damaging 1.00
RF013:Trim66 UTSW 7 109,059,960 (GRCm39) missense probably damaging 0.99
RF024:Trim66 UTSW 7 109,059,947 (GRCm39) missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- GGGGAAAGACCATCATTGCTTCATTGC -3'
(R):5'- TCATGGTGTGTAAACAGCTACAAGGGG -3'

Sequencing Primer
(F):5'- CTTCATTGCTGACTTAGGGAAAAGG -3'
(R):5'- GCTACAAGGGGCAGGGC -3'
Posted On 2013-11-18