Mutagenetix > Incidental Mutation

Incidental Mutation 'R1078:Plekhg4'

85733

Institutional Source

Beutler Lab

Gene Symbol

Plekhg4

Ensembl Gene

ENSMUSG00000014782

Gene Name

pleckstrin homology domain containing, family G (with RhoGef domain) member 4

Synonyms

4931414L13Rik

MMRRC Submission

039164-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R1078 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105373274-105382862 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 105381677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1117 (C1117*)

Ref Sequence

ENSEMBL: ENSMUSP00000150574 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]

AlphaFold

A0A1L1SU27

Predicted Effect

probably null
Transcript: ENSMUST00000014927
AA Change: C1081*

SMART Domains

Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782
AA Change: C1081*

Domain	Start	End	E-Value	Type
low complexity region	364	377	N/A	INTRINSIC
low complexity region	440	451	N/A	INTRINSIC
low complexity region	463	475	N/A	INTRINSIC
low complexity region	535	547	N/A	INTRINSIC
low complexity region	559	577	N/A	INTRINSIC
low complexity region	653	664	N/A	INTRINSIC
low complexity region	701	718	N/A	INTRINSIC
RhoGEF	729	900	3.15e-29	SMART
PH	914	1022	1.44e-5	SMART
low complexity region	1148	1169	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000063071

SMART Domains

Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648

Domain	Start	End	E-Value	Type
Pfam:BTB_2	15	92	1.3e-9	PFAM
internal_repeat_1	173	251	8.34e-9	PROSPERO
internal_repeat_1	429	509	8.34e-9	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000159286

SMART Domains

Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

Domain	Start	End	E-Value	Type
SCOP:d1aua_2	136	275	5e-9	SMART
Blast:SEC14	137	271	9e-8	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000160191
AA Change: C1012*

SMART Domains

Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782
AA Change: C1012*

Domain	Start	End	E-Value	Type
low complexity region	295	308	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	394	406	N/A	INTRINSIC
low complexity region	466	478	N/A	INTRINSIC
low complexity region	490	508	N/A	INTRINSIC
low complexity region	584	595	N/A	INTRINSIC
low complexity region	632	649	N/A	INTRINSIC
RhoGEF	660	831	3.15e-29	SMART
PH	845	953	1.44e-5	SMART
low complexity region	1079	1100	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161672

Predicted Effect

probably benign
Transcript: ENSMUST00000167294

SMART Domains

Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648

Domain	Start	End	E-Value	Type
Pfam:BTB_2	15	93	3.9e-10	PFAM
internal_repeat_1	173	251	6.24e-9	PROSPERO
internal_repeat_1	406	486	6.24e-9	PROSPERO

Predicted Effect

probably benign
Transcript: ENSMUST00000168196

Predicted Effect

probably null
Transcript: ENSMUST00000214056
AA Change: C1117*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.4%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can function as a guanine nucleotide exchange factor (GEF) and may play a role in intracellular signaling and cytoskeleton dynamics at the Golgi apparatus. Polymorphisms in the region of this gene have been found to be associated with spinocerebellar ataxia in some study populations. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,611,762	I358S	probably benign	Het
9130230L23Rik	T	C	5: 65,988,355	T138A	unknown	Het
Abi3bp	T	C	16: 56,654,081		probably null	Het
Alpk3	A	T	7: 81,078,600	M493L	probably benign	Het
Bace2	C	T	16: 97,356,860	A20V	unknown	Het
Bms1	T	C	6: 118,405,221	D452G	probably benign	Het
Ccdc187	T	C	2: 26,294,377	T3A	probably damaging	Het
Ctu2	T	C	8: 122,481,499	V95A	possibly damaging	Het
Cyp2a5	A	G	7: 26,835,541	K60E	probably benign	Het
Cyp4f13	T	C	17: 32,925,568	H318R	probably damaging	Het
Dlgap5	G	A	14: 47,399,566	T485M	probably damaging	Het
Dsp	C	T	13: 38,183,106		probably benign	Het
Ell2	T	C	13: 75,746,419		probably benign	Het
Eml2	A	T	7: 19,179,762	Y168F	probably benign	Het
Ep400	C	T	5: 110,735,522		probably benign	Het
Ercc4	C	A	16: 13,130,197	A336D	probably benign	Het
Fam189a2	T	A	19: 23,973,575	R547S	probably benign	Het
Fat4	T	C	3: 38,983,086	L3629S	probably benign	Het
Gabbr2	C	T	4: 46,664,833	R925H	probably damaging	Het
Gfi1b	A	T	2: 28,613,865	W108R	probably damaging	Het
Gtse1	C	T	15: 85,862,307	P108L	probably damaging	Het
Hfm1	A	T	5: 106,878,830	F140I	probably damaging	Het
Hyal2	T	A	9: 107,572,246	H400Q	probably benign	Het
Igfn1	A	G	1: 135,974,847	Y371H	probably damaging	Het
Iltifb	T	G	10: 118,290,151	*180C	probably null	Het
Kdm2b	T	C	5: 122,961,541	T118A	possibly damaging	Het
Lama5	A	T	2: 180,179,764		probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lmo7	C	T	14: 101,920,474		probably benign	Het
Lrrc37a	G	T	11: 103,497,631	P2323T	unknown	Het
Lrrc38	A	G	4: 143,350,518	Y117C	probably benign	Het
Myo1e	T	C	9: 70,383,999	V1024A	probably benign	Het
Myrfl	T	C	10: 116,776,732	N904S	possibly damaging	Het
Olfr1015	T	C	2: 85,786,093	V194A	possibly damaging	Het
Olfr103	T	A	17: 37,337,026	I69F	probably damaging	Het
Olfr1297	T	C	2: 111,621,345	H243R	probably damaging	Het
Pld4	A	T	12: 112,763,442	I53F	probably benign	Het
Prss39	G	A	1: 34,502,086	E224K	probably benign	Het
Psme1	G	T	14: 55,580,650	G149V	probably damaging	Het
Soat2	T	A	15: 102,153,138		probably null	Het
Stab2	C	T	10: 86,907,133		probably null	Het
Tcf7l2	A	G	19: 55,743,195	T127A	probably benign	Het
Tcp1	T	C	17: 12,923,204		probably benign	Het
Thbs4	G	A	13: 92,762,926		probably benign	Het
Tmf1	T	C	6: 97,173,300	D482G	probably damaging	Het
Trim66	G	T	7: 109,472,319	P591H	probably damaging	Het
Umodl1	T	C	17: 30,959,373	S108P	probably benign	Het
Unc79	T	G	12: 103,074,853	M715R	probably benign	Het
Usp34	C	A	11: 23,433,175		probably benign	Het
Utrn	T	G	10: 12,455,566		probably null	Het
Zfp830	T	C	11: 82,765,339		probably null	Het

Other mutations in Plekhg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00515:Plekhg4	APN	8	105375738	missense	probably benign	0.01
IGL00970:Plekhg4	APN	8	105378435	missense	probably benign	0.02
IGL01784:Plekhg4	APN	8	105378957	missense	probably damaging	1.00
IGL02063:Plekhg4	APN	8	105379252	splice site	probably benign
IGL02371:Plekhg4	APN	8	105379059	splice site	probably null
IGL02984:Plekhg4	UTSW	8	105380388	missense	probably damaging	1.00
R0013:Plekhg4	UTSW	8	105375396	nonsense	probably null
R0105:Plekhg4	UTSW	8	105382012	missense	possibly damaging	0.65
R0105:Plekhg4	UTSW	8	105382012	missense	possibly damaging	0.65
R0631:Plekhg4	UTSW	8	105379302	missense	probably damaging	1.00
R1201:Plekhg4	UTSW	8	105381673	missense	probably damaging	1.00
R1222:Plekhg4	UTSW	8	105379110	missense	probably benign	0.03
R1418:Plekhg4	UTSW	8	105379110	missense	probably benign	0.03
R1459:Plekhg4	UTSW	8	105381799	missense	probably damaging	0.98
R1465:Plekhg4	UTSW	8	105381040	splice site	probably benign
R1558:Plekhg4	UTSW	8	105381835	missense	possibly damaging	0.73
R1637:Plekhg4	UTSW	8	105381781	missense	probably benign	0.08
R1757:Plekhg4	UTSW	8	105381661	missense	probably damaging	0.99
R1922:Plekhg4	UTSW	8	105378385	missense	probably damaging	1.00
R1961:Plekhg4	UTSW	8	105381464	missense	probably damaging	0.99
R2074:Plekhg4	UTSW	8	105376452	small deletion	probably benign
R2113:Plekhg4	UTSW	8	105379434	missense	probably damaging	1.00
R2124:Plekhg4	UTSW	8	105376452	small deletion	probably benign
R2196:Plekhg4	UTSW	8	105376452	small deletion	probably benign
R2321:Plekhg4	UTSW	8	105377540	missense	probably benign	0.00
R2432:Plekhg4	UTSW	8	105381836	missense	probably benign	0.00
R2908:Plekhg4	UTSW	8	105380861	missense	probably damaging	1.00
R2910:Plekhg4	UTSW	8	105376452	small deletion	probably benign
R4179:Plekhg4	UTSW	8	105381398	missense	possibly damaging	0.93
R4180:Plekhg4	UTSW	8	105381398	missense	possibly damaging	0.93
R4513:Plekhg4	UTSW	8	105380402	missense	probably damaging	1.00
R4678:Plekhg4	UTSW	8	105380371	nonsense	probably null
R4946:Plekhg4	UTSW	8	105381996	missense	probably null	0.01
R5223:Plekhg4	UTSW	8	105378949	missense	probably benign	0.18
R5362:Plekhg4	UTSW	8	105381398	missense	possibly damaging	0.93
R5454:Plekhg4	UTSW	8	105376113	critical splice donor site	probably null
R5609:Plekhg4	UTSW	8	105379502	critical splice donor site	probably null
R5624:Plekhg4	UTSW	8	105380750	missense	probably damaging	0.99
R5806:Plekhg4	UTSW	8	105378910	missense	possibly damaging	0.85
R6297:Plekhg4	UTSW	8	105377840	missense	probably damaging	1.00
R7198:Plekhg4	UTSW	8	105378697	missense	probably damaging	1.00
R7443:Plekhg4	UTSW	8	105380867	missense	probably damaging	1.00
R7570:Plekhg4	UTSW	8	105378684	missense	possibly damaging	0.95
R7577:Plekhg4	UTSW	8	105375399	missense	probably benign
R7632:Plekhg4	UTSW	8	105380150	missense	probably damaging	1.00
R7782:Plekhg4	UTSW	8	105377767	missense	probably benign	0.14
R7958:Plekhg4	UTSW	8	105376649	missense	possibly damaging	0.86
R8239:Plekhg4	UTSW	8	105380914	nonsense	probably null
R8335:Plekhg4	UTSW	8	105376216	missense	probably damaging	0.97
R8411:Plekhg4	UTSW	8	105377329	nonsense	probably null
R9011:Plekhg4	UTSW	8	105375652	missense	probably benign	0.23
R9017:Plekhg4	UTSW	8	105378700	missense	possibly damaging	0.85
R9255:Plekhg4	UTSW	8	105376639	missense	probably benign	0.00
R9297:Plekhg4	UTSW	8	105379275	missense	probably damaging	1.00
R9391:Plekhg4	UTSW	8	105379411	missense	probably damaging	1.00
R9524:Plekhg4	UTSW	8	105374766	missense	unknown
R9613:Plekhg4	UTSW	8	105380988	missense	probably damaging	1.00
R9683:Plekhg4	UTSW	8	105376291	missense	probably benign	0.00
Z1177:Plekhg4	UTSW	8	105374842	missense	unknown

Predicted Primers

PCR Primer
(F):5'- CCGCAACATCAACTATGTGCTGAAG -3'
(R):5'- GCTGCTGTCAGAATCACTAGAGCC -3'

Sequencing Primer
(F):5'- CATCAACTATGTGCTGAAGAGACG -3'
(R):5'- ACTGGGATGAGACCTCTGAGTC -3'

Posted On

2013-11-18