Incidental Mutation 'R1078:Ctu2'
ID85734
Institutional Source Beutler Lab
Gene Symbol Ctu2
Ensembl Gene ENSMUSG00000049482
Gene Namecytosolic thiouridylase subunit 2
Synonyms2310061F22Rik
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1078 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location122476143-122484138 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122481499 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 95 (V95A)
Ref Sequence ENSEMBL: ENSMUSP00000116104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067252] [ENSMUST00000116412] [ENSMUST00000127664] [ENSMUST00000128383] [ENSMUST00000134127] [ENSMUST00000136253] [ENSMUST00000146634] [ENSMUST00000156333] [ENSMUST00000151855]
Predicted Effect probably benign
Transcript: ENSMUST00000067252
SMART Domains Protein: ENSMUSP00000089777
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 156 169 N/A INTRINSIC
transmembrane domain 211 233 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 316 333 N/A INTRINSIC
low complexity region 353 368 N/A INTRINSIC
low complexity region 396 408 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
transmembrane domain 513 535 N/A INTRINSIC
internal_repeat_1 541 658 5.31e-5 PROSPERO
transmembrane domain 685 707 N/A INTRINSIC
low complexity region 738 753 N/A INTRINSIC
transmembrane domain 817 839 N/A INTRINSIC
transmembrane domain 844 866 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
transmembrane domain 979 1001 N/A INTRINSIC
transmembrane domain 1005 1022 N/A INTRINSIC
transmembrane domain 1035 1057 N/A INTRINSIC
transmembrane domain 1154 1171 N/A INTRINSIC
transmembrane domain 1178 1197 N/A INTRINSIC
Pfam:PIEZO 1229 1458 1.1e-97 PFAM
low complexity region 1475 1486 N/A INTRINSIC
internal_repeat_1 1646 1752 5.31e-5 PROSPERO
low complexity region 1905 1921 N/A INTRINSIC
transmembrane domain 1976 1998 N/A INTRINSIC
transmembrane domain 2018 2038 N/A INTRINSIC
transmembrane domain 2045 2067 N/A INTRINSIC
transmembrane domain 2077 2094 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2126 2544 3.2e-157 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116412
AA Change: V485A

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112113
Gene: ENSMUSG00000049482
AA Change: V485A

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 1e-3 SMART
Pfam:CTU2 347 470 2.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123671
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126553
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128383
SMART Domains Protein: ENSMUSP00000116194
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
transmembrane domain 31 53 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
transmembrane domain 169 188 N/A INTRINSIC
transmembrane domain 195 217 N/A INTRINSIC
transmembrane domain 247 269 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
transmembrane domain 379 401 N/A INTRINSIC
transmembrane domain 406 428 N/A INTRINSIC
low complexity region 502 514 N/A INTRINSIC
transmembrane domain 541 563 N/A INTRINSIC
transmembrane domain 567 584 N/A INTRINSIC
transmembrane domain 597 619 N/A INTRINSIC
transmembrane domain 716 733 N/A INTRINSIC
transmembrane domain 740 759 N/A INTRINSIC
transmembrane domain 774 796 N/A INTRINSIC
transmembrane domain 803 820 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
coiled coil region 895 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131934
Predicted Effect probably benign
Transcript: ENSMUST00000134127
SMART Domains Protein: ENSMUSP00000119237
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 23 N/A INTRINSIC
SCOP:d1sur__ 25 128 4e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134304
Predicted Effect possibly damaging
Transcript: ENSMUST00000136253
AA Change: V95A

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000146634
SMART Domains Protein: ENSMUSP00000119931
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
low complexity region 78 87 N/A INTRINSIC
low complexity region 96 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148497
SMART Domains Protein: ENSMUSP00000121725
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
low complexity region 288 300 N/A INTRINSIC
transmembrane domain 351 373 N/A INTRINSIC
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 505 522 N/A INTRINSIC
transmembrane domain 529 548 N/A INTRINSIC
Pfam:PIEZO 580 809 3.2e-98 PFAM
low complexity region 826 837 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1046 1063 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212499
AA Change: V27A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154099
Predicted Effect probably benign
Transcript: ENSMUST00000156333
SMART Domains Protein: ENSMUSP00000114584
Gene: ENSMUSG00000014444

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
transmembrane domain 29 46 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 121 143 N/A INTRINSIC
low complexity region 157 170 N/A INTRINSIC
transmembrane domain 212 234 N/A INTRINSIC
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 317 334 N/A INTRINSIC
low complexity region 354 369 N/A INTRINSIC
low complexity region 397 409 N/A INTRINSIC
transmembrane domain 434 456 N/A INTRINSIC
transmembrane domain 469 491 N/A INTRINSIC
transmembrane domain 514 536 N/A INTRINSIC
internal_repeat_1 542 659 4.88e-5 PROSPERO
transmembrane domain 686 708 N/A INTRINSIC
low complexity region 739 754 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
transmembrane domain 845 867 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
transmembrane domain 980 1002 N/A INTRINSIC
transmembrane domain 1006 1023 N/A INTRINSIC
transmembrane domain 1036 1058 N/A INTRINSIC
transmembrane domain 1155 1172 N/A INTRINSIC
transmembrane domain 1179 1198 N/A INTRINSIC
Pfam:PIEZO 1230 1459 2.3e-94 PFAM
low complexity region 1476 1487 N/A INTRINSIC
internal_repeat_1 1647 1753 4.88e-5 PROSPERO
low complexity region 1906 1922 N/A INTRINSIC
transmembrane domain 1977 1999 N/A INTRINSIC
transmembrane domain 2019 2039 N/A INTRINSIC
transmembrane domain 2046 2068 N/A INTRINSIC
transmembrane domain 2078 2095 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2127 2545 8.7e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151855
SMART Domains Protein: ENSMUSP00000133622
Gene: ENSMUSG00000049482

DomainStartEndE-ValueType
low complexity region 11 24 N/A INTRINSIC
SCOP:d1sur__ 47 153 9e-4 SMART
Pfam:DUF2392 277 377 1.7e-30 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is involved in the post-transcriptional modification of transfer RNAs (tRNAs). The encoded protein plays a role in thiolation of uridine residue present at the wobble position in a subset of tRNAs, resulting in enhanced codon reading accuracy. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Ctu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ctu2 APN 8 122477238 unclassified probably benign
IGL01764:Ctu2 APN 8 122479422 unclassified probably benign
IGL02190:Ctu2 APN 8 122481658 utr 3 prime probably benign
IGL02869:Ctu2 APN 8 122478791 splice site probably null
IGL03136:Ctu2 APN 8 122479201 unclassified probably benign
IGL03139:Ctu2 APN 8 122478707 missense possibly damaging 0.65
IGL03237:Ctu2 APN 8 122479053 missense probably benign 0.00
PIT4354001:Ctu2 UTSW 8 122478975 missense probably damaging 0.99
R0001:Ctu2 UTSW 8 122478920 missense probably benign
R0359:Ctu2 UTSW 8 122478193 missense probably damaging 0.99
R1938:Ctu2 UTSW 8 122479285 missense probably damaging 1.00
R2143:Ctu2 UTSW 8 122479152 missense probably benign 0.16
R2145:Ctu2 UTSW 8 122479152 missense probably benign 0.16
R2221:Ctu2 UTSW 8 122480910 missense probably damaging 1.00
R4111:Ctu2 UTSW 8 122476517 missense possibly damaging 0.64
R4284:Ctu2 UTSW 8 122478239 missense probably benign 0.04
R4704:Ctu2 UTSW 8 122479303 missense probably damaging 1.00
R4774:Ctu2 UTSW 8 122481112 missense probably benign 0.17
R5254:Ctu2 UTSW 8 122476588 missense probably damaging 1.00
R5804:Ctu2 UTSW 8 122481226 critical splice donor site probably null
R5935:Ctu2 UTSW 8 122476954 unclassified probably benign
R7378:Ctu2 UTSW 8 122481499 missense probably damaging 0.99
R7911:Ctu2 UTSW 8 122480994 missense probably benign 0.01
R8546:Ctu2 UTSW 8 122479363 missense probably damaging 1.00
R8876:Ctu2 UTSW 8 122480212 missense
Predicted Primers PCR Primer
(F):5'- ACAGTTCAGAGTGAGACCAGGCAC -3'
(R):5'- GCCCTGATGATGCTGCTGTCAAAG -3'

Sequencing Primer
(F):5'- AGGCACATAAATCTACTTCTGCTTC -3'
(R):5'- CCCACAAGTACTGTAGGGTTTTC -3'
Posted On2013-11-18