Incidental Mutation 'R1078:Hyal2'
ID85736
Institutional Source Beutler Lab
Gene Symbol Hyal2
Ensembl Gene ENSMUSG00000010047
Gene Namehyaluronoglucosaminidase 2
Synonyms
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1078 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location107567945-107572779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107572246 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 400 (H400Q)
Ref Sequence ENSEMBL: ENSMUSP00000141280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010191] [ENSMUST00000010195] [ENSMUST00000112387] [ENSMUST00000123005] [ENSMUST00000144392] [ENSMUST00000192887] [ENSMUST00000193747] [ENSMUST00000194794] [ENSMUST00000195681] [ENSMUST00000195752]
Predicted Effect probably benign
Transcript: ENSMUST00000010191
AA Change: H400Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000010191
Gene: ENSMUSG00000010047
AA Change: H400Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 29 362 9.6e-140 PFAM
EGF 364 439 4.26e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000010195
SMART Domains Protein: ENSMUSP00000010195
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 53 383 5.7e-134 PFAM
EGF 385 458 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112387
SMART Domains Protein: ENSMUSP00000108006
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 384 7e-153 PFAM
Blast:EGF 385 454 1e-42 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123005
SMART Domains Protein: ENSMUSP00000122601
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 1 104 6.8e-37 PFAM
EGF 105 178 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144392
SMART Domains Protein: ENSMUSP00000120599
Gene: ENSMUSG00000010051

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 330 1.8e-128 PFAM
Pfam:Glyco_hydro_56 325 354 2.6e-8 PFAM
EGF 355 428 1.4e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181099
Predicted Effect probably benign
Transcript: ENSMUST00000192887
SMART Domains Protein: ENSMUSP00000142207
Gene: ENSMUSG00000010047

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 82 5.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193747
SMART Domains Protein: ENSMUSP00000142141
Gene: ENSMUSG00000010047

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 342 5.4e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194794
SMART Domains Protein: ENSMUSP00000142019
Gene: ENSMUSG00000010047

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 154 8.8e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195667
Predicted Effect probably benign
Transcript: ENSMUST00000195681
SMART Domains Protein: ENSMUSP00000141820
Gene: ENSMUSG00000010047

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 325 3.8e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195752
AA Change: H400Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141280
Gene: ENSMUSG00000010047
AA Change: H400Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 363 1.1e-144 PFAM
EGF 364 439 4.26e0 SMART
Meta Mutation Damage Score 0.0922 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a weak acid-active hyaluronidase. The encoded protein is similar in structure to other more active hyaluronidases. Hyaluronidases degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan and fragments of hyaluronan are thought to be involved in cell proliferation, migration and differentiation. Although it was previously thought to be a lysosomal hyaluronidase that is active at a pH below 4, the encoded protein is likely a GPI-anchored cell surface protein. This hyaluronidase serves as a receptor for the oncogenic virus Jaagsiekte sheep retrovirus. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. This gene encodes two alternatively spliced transcript variants which differ only in the 5' UTR.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, poor survival, craniofacial defects, and mild anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Hyal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Hyal2 APN 9 107570405 missense probably damaging 1.00
IGL00337:Hyal2 APN 9 107572172 missense probably damaging 1.00
IGL01834:Hyal2 APN 9 107570906 missense probably damaging 1.00
IGL02469:Hyal2 APN 9 107572212 missense probably damaging 1.00
R0505:Hyal2 UTSW 9 107572071 missense probably benign 0.28
R1543:Hyal2 UTSW 9 107570187 missense probably damaging 0.98
R1858:Hyal2 UTSW 9 107572338 missense probably benign 0.01
R1974:Hyal2 UTSW 9 107572172 missense probably damaging 1.00
R3842:Hyal2 UTSW 9 107572121 missense probably damaging 0.99
R4400:Hyal2 UTSW 9 107570853 missense probably damaging 1.00
R5111:Hyal2 UTSW 9 107571111 missense probably benign 0.00
R5922:Hyal2 UTSW 9 107570907 missense probably damaging 1.00
R6026:Hyal2 UTSW 9 107572199 missense probably benign 0.00
R6266:Hyal2 UTSW 9 107570715 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CCTTTTCCAGGAGACCTGCCAATAC -3'
(R):5'- TCATAAGGTCCAGGTGAGAGCCAC -3'

Sequencing Primer
(F):5'- GGAGACCTGCCAATACCTCAAG -3'
(R):5'- CAGGTGAGAGCCACAGCTAC -3'
Posted On2013-11-18