Incidental Mutation 'R1078:Dlgap5'
ID85750
Institutional Source Beutler Lab
Gene Symbol Dlgap5
Ensembl Gene ENSMUSG00000037544
Gene NameDLG associated protein 5
SynonymsDlg7, C86398, Hurp
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R1078 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location47387779-47418407 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 47399566 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 485 (T485M)
Ref Sequence ENSEMBL: ENSMUSP00000153953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043296] [ENSMUST00000178661] [ENSMUST00000180299]
Predicted Effect probably damaging
Transcript: ENSMUST00000043296
AA Change: T485M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040416
Gene: ENSMUSG00000037544
AA Change: T485M

DomainStartEndE-ValueType
coiled coil region 86 116 N/A INTRINSIC
Pfam:GKAP 327 590 2.2e-38 PFAM
low complexity region 735 757 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000111778
AA Change: T283M
SMART Domains Protein: ENSMUSP00000107408
Gene: ENSMUSG00000037544
AA Change: T283M

DomainStartEndE-ValueType
Pfam:GKAP 78 303 3.9e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000178661
AA Change: T485M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179465
Predicted Effect probably damaging
Transcript: ENSMUST00000180299
AA Change: T485M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display female infertility resulting from a defect in decidualization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Dlgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Dlgap5 APN 14 47398468 missense probably damaging 1.00
IGL01110:Dlgap5 APN 14 47394326 splice site probably benign
IGL02943:Dlgap5 APN 14 47412976 critical splice donor site probably null
PIT4453001:Dlgap5 UTSW 14 47401522 frame shift probably null
R0189:Dlgap5 UTSW 14 47412975 splice site probably null
R0383:Dlgap5 UTSW 14 47410361 missense probably benign 0.01
R1915:Dlgap5 UTSW 14 47407773 missense probably benign 0.00
R1959:Dlgap5 UTSW 14 47416386 missense possibly damaging 0.88
R2051:Dlgap5 UTSW 14 47411484 missense probably benign 0.01
R2145:Dlgap5 UTSW 14 47395923 nonsense probably null
R2922:Dlgap5 UTSW 14 47390441 critical splice donor site probably null
R4261:Dlgap5 UTSW 14 47413788 missense probably damaging 1.00
R4607:Dlgap5 UTSW 14 47413018 missense possibly damaging 0.87
R4724:Dlgap5 UTSW 14 47401520 critical splice donor site probably null
R4898:Dlgap5 UTSW 14 47413819 missense probably benign 0.01
R5135:Dlgap5 UTSW 14 47399665 missense probably damaging 1.00
R5154:Dlgap5 UTSW 14 47413720 missense probably damaging 1.00
R5650:Dlgap5 UTSW 14 47411739 missense probably benign 0.01
R5849:Dlgap5 UTSW 14 47389435 missense possibly damaging 0.95
R5958:Dlgap5 UTSW 14 47413754 missense probably damaging 1.00
R6845:Dlgap5 UTSW 14 47416563 missense possibly damaging 0.79
R7163:Dlgap5 UTSW 14 47399638 missense probably damaging 1.00
R7529:Dlgap5 UTSW 14 47416419 missense probably damaging 1.00
R7646:Dlgap5 UTSW 14 47399519 critical splice donor site probably null
R8029:Dlgap5 UTSW 14 47416440 missense probably benign 0.01
R8084:Dlgap5 UTSW 14 47407841 missense probably benign 0.00
Z1177:Dlgap5 UTSW 14 47388063 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACACAACTGACTGCTTGCTCTG -3'
(R):5'- TGGCTTGCTATAAAGGCCCGTTTTC -3'

Sequencing Primer
(F):5'- ccctggctgtctgcaag -3'
(R):5'- GCTATAAAGGCCCGTTTTCATTTC -3'
Posted On2013-11-18