Incidental Mutation 'R1078:Psme1'
ID 85751
Institutional Source Beutler Lab
Gene Symbol Psme1
Ensembl Gene ENSMUSG00000022216
Gene Name proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)
Synonyms PA28a
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1078 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 55578123-55581529 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 55580650 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 149 (G149V)
Ref Sequence ENSEMBL: ENSMUSP00000133883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022826] [ENSMUST00000022828] [ENSMUST00000089619] [ENSMUST00000172738] [ENSMUST00000174259] [ENSMUST00000174563] [ENSMUST00000174484]
AlphaFold P97371
Predicted Effect probably benign
Transcript: ENSMUST00000022826
SMART Domains Protein: ENSMUSP00000022826
Gene: ENSMUSG00000022215

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 95 114 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
transmembrane domain 250 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000022828
SMART Domains Protein: ENSMUSP00000022828
Gene: ENSMUSG00000022217

DomainStartEndE-ValueType
Pfam:UPF0172 3 191 1.9e-59 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000089619
AA Change: G149V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087046
Gene: ENSMUSG00000022216
AA Change: G149V

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 4.1e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 100 236 2.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135068
Predicted Effect probably benign
Transcript: ENSMUST00000172738
SMART Domains Protein: ENSMUSP00000133867
Gene: ENSMUSG00000022216

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 3.8e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 129 226 3.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173169
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174148
Predicted Effect probably damaging
Transcript: ENSMUST00000174259
AA Change: G149V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134735
Gene: ENSMUSG00000022216
AA Change: G149V

DomainStartEndE-ValueType
Pfam:PA28_alpha 8 68 6e-27 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 103 247 9.5e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174563
AA Change: G138V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133366
Gene: ENSMUSG00000022216
AA Change: G138V

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 58 7.5e-18 PFAM
low complexity region 59 87 N/A INTRINSIC
Pfam:PA28_beta 89 173 5.4e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174484
AA Change: G149V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133883
Gene: ENSMUSG00000022216
AA Change: G149V

DomainStartEndE-ValueType
Pfam:PA28_alpha 6 69 4.4e-29 PFAM
low complexity region 70 98 N/A INTRINSIC
Pfam:PA28_beta 100 238 7.7e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174618
Predicted Effect probably benign
Transcript: ENSMUST00000174352
SMART Domains Protein: ENSMUSP00000133463
Gene: ENSMUSG00000022217

DomainStartEndE-ValueType
Pfam:UPF0172 1 43 6.3e-11 PFAM
Pfam:UPF0172 41 82 1.2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228834
Predicted Effect probably benign
Transcript: ENSMUST00000174419
Meta Mutation Damage Score 0.9681 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Psme1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02532:Psme1 APN 14 55581138 nonsense probably null
IGL02867:Psme1 APN 14 55579926 splice site probably benign
IGL02889:Psme1 APN 14 55579926 splice site probably benign
IGL03257:Psme1 APN 14 55580629 missense probably damaging 1.00
R0491:Psme1 UTSW 14 55579921 splice site probably benign
R1597:Psme1 UTSW 14 55580765 missense probably damaging 1.00
R7620:Psme1 UTSW 14 55580340 nonsense probably null
R8050:Psme1 UTSW 14 55579599 missense possibly damaging 0.86
R8903:Psme1 UTSW 14 55580396 missense
R9022:Psme1 UTSW 14 55579814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTCGCACGCCCAGTCATTC -3'
(R):5'- TGTTGTGATGAGGCCACTCACTTG -3'

Sequencing Primer
(F):5'- TGTCACTGAGCAACTCAATCTGG -3'
(R):5'- ACTCACTTGGAGATCTGCG -3'
Posted On 2013-11-18