Mutagenetix > Incidental Mutation

Incidental Mutation 'R1078:Lmo7'

85752

Institutional Source

Beutler Lab

Gene Symbol

Lmo7

Ensembl Gene

ENSMUSG00000033060

Gene Name

LIM domain only 7

Synonyms

FBXO20, LOC380928

MMRRC Submission

039164-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.127) question?

Stock #

R1078 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

101729957-101934710 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

C to T at 101920474 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000100337] [ENSMUST00000159258] [ENSMUST00000159314] [ENSMUST00000159597]

AlphaFold

E9PYF4

Predicted Effect

probably benign
Transcript: ENSMUST00000100337

SMART Domains

Protein: ENSMUSP00000097910
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
CH	14	124	2.57e-13	SMART
low complexity region	200	211	N/A	INTRINSIC
Pfam:DUF4757	242	348	2.2e-14	PFAM
low complexity region	448	462	N/A	INTRINSIC
Pfam:DUF4757	568	735	1.8e-46	PFAM
low complexity region	861	879	N/A	INTRINSIC
low complexity region	979	991	N/A	INTRINSIC
low complexity region	1003	1015	N/A	INTRINSIC
PDZ	1047	1119	1.05e-8	SMART
coiled coil region	1222	1275	N/A	INTRINSIC
coiled coil region	1319	1411	N/A	INTRINSIC
low complexity region	1585	1596	N/A	INTRINSIC
low complexity region	1599	1617	N/A	INTRINSIC
LIM	1629	1687	6.54e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159154

Predicted Effect

probably benign
Transcript: ENSMUST00000159258

SMART Domains

Protein: ENSMUSP00000125465
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159314

SMART Domains

Protein: ENSMUSP00000124349
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	215	229	N/A	INTRINSIC
coiled coil region	435	492	N/A	INTRINSIC
low complexity region	628	646	N/A	INTRINSIC
low complexity region	746	758	N/A	INTRINSIC
low complexity region	770	782	N/A	INTRINSIC
PDZ	814	886	1.05e-8	SMART
coiled coil region	989	1042	N/A	INTRINSIC
coiled coil region	1086	1178	N/A	INTRINSIC
low complexity region	1352	1363	N/A	INTRINSIC
low complexity region	1366	1384	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159597

SMART Domains

Protein: ENSMUSP00000123706
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	78	89	N/A	INTRINSIC
internal_repeat_1	111	141	6.96e-5	PROSPERO
internal_repeat_1	218	248	6.96e-5	PROSPERO
low complexity region	326	340	N/A	INTRINSIC
coiled coil region	546	603	N/A	INTRINSIC
low complexity region	739	757	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	881	893	N/A	INTRINSIC
PDZ	925	997	1.05e-8	SMART
coiled coil region	1127	1180	N/A	INTRINSIC
coiled coil region	1224	1316	N/A	INTRINSIC
low complexity region	1490	1501	N/A	INTRINSIC
low complexity region	1504	1522	N/A	INTRINSIC
LIM	1534	1592	6.54e-10	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159806

SMART Domains

Protein: ENSMUSP00000124300
Gene: ENSMUSG00000033060

Domain	Start	End	E-Value	Type
low complexity region	34	45	N/A	INTRINSIC
Pfam:DUF4757	76	225	4.5e-53	PFAM
low complexity region	351	369	N/A	INTRINSIC
low complexity region	469	481	N/A	INTRINSIC
low complexity region	493	505	N/A	INTRINSIC
PDZ	537	609	1.05e-8	SMART
internal_repeat_1	620	691	9.31e-5	PROSPERO
coiled coil region	711	764	N/A	INTRINSIC
coiled coil region	808	900	N/A	INTRINSIC
internal_repeat_1	921	976	9.31e-5	PROSPERO
low complexity region	1075	1086	N/A	INTRINSIC
low complexity region	1089	1107	N/A	INTRINSIC
LIM	1119	1177	6.54e-10	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.4%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a calponin homology (CH) domain, a PDZ domain, and a LIM domain, and may be involved in protein-protein interactions. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene, however, the full-length nature of some variants is not known. [provided by RefSeq, Jan 2009]
PHENOTYPE: Targeted mutations in this gene result in postnatal lethality, growth defects, skeletal muscle abnormalities and retinal defects reflective of retinal degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,611,762	I358S	probably benign	Het
9130230L23Rik	T	C	5: 65,988,355	T138A	unknown	Het
Abi3bp	T	C	16: 56,654,081		probably null	Het
Alpk3	A	T	7: 81,078,600	M493L	probably benign	Het
Bace2	C	T	16: 97,356,860	A20V	unknown	Het
Bms1	T	C	6: 118,405,221	D452G	probably benign	Het
Ccdc187	T	C	2: 26,294,377	T3A	probably damaging	Het
Ctu2	T	C	8: 122,481,499	V95A	possibly damaging	Het
Cyp2a5	A	G	7: 26,835,541	K60E	probably benign	Het
Cyp4f13	T	C	17: 32,925,568	H318R	probably damaging	Het
Dlgap5	G	A	14: 47,399,566	T485M	probably damaging	Het
Dsp	C	T	13: 38,183,106		probably benign	Het
Ell2	T	C	13: 75,746,419		probably benign	Het
Eml2	A	T	7: 19,179,762	Y168F	probably benign	Het
Ep400	C	T	5: 110,735,522		probably benign	Het
Ercc4	C	A	16: 13,130,197	A336D	probably benign	Het
Fam189a2	T	A	19: 23,973,575	R547S	probably benign	Het
Fat4	T	C	3: 38,983,086	L3629S	probably benign	Het
Gabbr2	C	T	4: 46,664,833	R925H	probably damaging	Het
Gfi1b	A	T	2: 28,613,865	W108R	probably damaging	Het
Gtse1	C	T	15: 85,862,307	P108L	probably damaging	Het
Hfm1	A	T	5: 106,878,830	F140I	probably damaging	Het
Hyal2	T	A	9: 107,572,246	H400Q	probably benign	Het
Igfn1	A	G	1: 135,974,847	Y371H	probably damaging	Het
Iltifb	T	G	10: 118,290,151	*180C	probably null	Het
Kdm2b	T	C	5: 122,961,541	T118A	possibly damaging	Het
Lama5	A	T	2: 180,179,764		probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lrrc37a	G	T	11: 103,497,631	P2323T	unknown	Het
Lrrc38	A	G	4: 143,350,518	Y117C	probably benign	Het
Myo1e	T	C	9: 70,383,999	V1024A	probably benign	Het
Myrfl	T	C	10: 116,776,732	N904S	possibly damaging	Het
Olfr1015	T	C	2: 85,786,093	V194A	possibly damaging	Het
Olfr103	T	A	17: 37,337,026	I69F	probably damaging	Het
Olfr1297	T	C	2: 111,621,345	H243R	probably damaging	Het
Pld4	A	T	12: 112,763,442	I53F	probably benign	Het
Plekhg4	T	A	8: 105,381,677	C1117*	probably null	Het
Prss39	G	A	1: 34,502,086	E224K	probably benign	Het
Psme1	G	T	14: 55,580,650	G149V	probably damaging	Het
Soat2	T	A	15: 102,153,138		probably null	Het
Stab2	C	T	10: 86,907,133		probably null	Het
Tcf7l2	A	G	19: 55,743,195	T127A	probably benign	Het
Tcp1	T	C	17: 12,923,204		probably benign	Het
Thbs4	G	A	13: 92,762,926		probably benign	Het
Tmf1	T	C	6: 97,173,300	D482G	probably damaging	Het
Trim66	G	T	7: 109,472,319	P591H	probably damaging	Het
Umodl1	T	C	17: 30,959,373	S108P	probably benign	Het
Unc79	T	G	12: 103,074,853	M715R	probably benign	Het
Usp34	C	A	11: 23,433,175		probably benign	Het
Utrn	T	G	10: 12,455,566		probably null	Het
Zfp830	T	C	11: 82,765,339		probably null	Het

Other mutations in Lmo7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Lmo7	APN	14	101887051	missense	probably damaging	0.99
IGL00733:Lmo7	APN	14	101915702	missense	probably damaging	1.00
IGL00778:Lmo7	APN	14	101910885	splice site	probably benign
IGL01014:Lmo7	APN	14	101920557	splice site	probably benign
IGL01401:Lmo7	APN	14	101794277	nonsense	probably null
IGL01550:Lmo7	APN	14	101926140	utr 3 prime	probably benign
IGL01570:Lmo7	APN	14	101902371	critical splice donor site	probably null
IGL01602:Lmo7	APN	14	101910756	splice site	probably benign
IGL01605:Lmo7	APN	14	101910756	splice site	probably benign
IGL02012:Lmo7	APN	14	101888716	intron	probably benign
IGL02145:Lmo7	APN	14	101902223	missense	probably benign	0.00
IGL02236:Lmo7	APN	14	101926088	splice site	probably benign
IGL02318:Lmo7	APN	14	101900066	splice site	probably benign
IGL02345:Lmo7	APN	14	101887473	missense	probably damaging	1.00
IGL02498:Lmo7	APN	14	101807482	missense	probably benign	0.01
IGL02583:Lmo7	APN	14	101933924	utr 3 prime	probably benign
IGL02670:Lmo7	APN	14	101880980	missense	probably damaging	1.00
IGL02694:Lmo7	APN	14	101887170	missense	probably damaging	1.00
IGL03026:Lmo7	APN	14	101929333	utr 3 prime	probably benign
IGL03062:Lmo7	APN	14	101912079	missense	possibly damaging	0.66
IGL03068:Lmo7	APN	14	101875492	unclassified	probably benign
IGL03178:Lmo7	APN	14	101929260	nonsense	probably null
IGL03279:Lmo7	APN	14	101900508	missense	probably benign	0.30
PIT4458001:Lmo7	UTSW	14	101887487	nonsense	probably null
R0029:Lmo7	UTSW	14	101933921	utr 3 prime	probably benign
R0112:Lmo7	UTSW	14	101887193	nonsense	probably null
R0345:Lmo7	UTSW	14	101876877	missense	probably damaging	1.00
R0372:Lmo7	UTSW	14	101918053	splice site	probably benign
R0393:Lmo7	UTSW	14	101900456	missense	probably benign
R0514:Lmo7	UTSW	14	101887173	missense	probably damaging	1.00
R0514:Lmo7	UTSW	14	101896559	missense	probably damaging	1.00
R0526:Lmo7	UTSW	14	101900560	missense	probably damaging	1.00
R0615:Lmo7	UTSW	14	101876859	nonsense	probably null
R0900:Lmo7	UTSW	14	101887188	missense	probably damaging	1.00
R0961:Lmo7	UTSW	14	101794269	missense	probably benign	0.00
R0964:Lmo7	UTSW	14	101920567	splice site	probably benign
R1252:Lmo7	UTSW	14	101900583	missense	probably damaging	1.00
R1527:Lmo7	UTSW	14	101876828	missense	probably damaging	1.00
R1537:Lmo7	UTSW	14	101929264	utr 3 prime	probably benign
R1565:Lmo7	UTSW	14	101887521	missense	probably damaging	0.99
R1637:Lmo7	UTSW	14	101880832	missense	probably damaging	1.00
R1943:Lmo7	UTSW	14	101902302	missense	probably damaging	1.00
R1967:Lmo7	UTSW	14	101900215	missense	probably benign	0.36
R2002:Lmo7	UTSW	14	101887061	missense	probably benign	0.13
R2057:Lmo7	UTSW	14	101887178	missense	probably damaging	1.00
R2131:Lmo7	UTSW	14	101900238	missense	probably damaging	0.99
R2153:Lmo7	UTSW	14	101920515	utr 3 prime	probably benign
R2257:Lmo7	UTSW	14	101900130	missense	probably damaging	1.00
R2355:Lmo7	UTSW	14	101888685	missense	probably damaging	1.00
R2356:Lmo7	UTSW	14	101886945	missense	probably damaging	1.00
R2898:Lmo7	UTSW	14	101876914	missense	possibly damaging	0.93
R3847:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3848:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3849:Lmo7	UTSW	14	101922095	critical splice acceptor site	probably null
R3916:Lmo7	UTSW	14	101929342	utr 3 prime	probably benign
R4050:Lmo7	UTSW	14	101902277	nonsense	probably null
R4326:Lmo7	UTSW	14	101900074	missense	possibly damaging	0.93
R4357:Lmo7	UTSW	14	101887655	missense	probably null	1.00
R4571:Lmo7	UTSW	14	101887594	missense	probably damaging	0.96
R4658:Lmo7	UTSW	14	101886957	missense	probably damaging	1.00
R4857:Lmo7	UTSW	14	101887348	splice site	probably null
R5006:Lmo7	UTSW	14	101926237	utr 3 prime	probably benign
R5528:Lmo7	UTSW	14	101902086	missense	probably damaging	1.00
R5588:Lmo7	UTSW	14	101896590	splice site	probably null
R5643:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5644:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R5650:Lmo7	UTSW	14	101898674	missense	probably damaging	1.00
R5737:Lmo7	UTSW	14	101887236	missense	probably damaging	1.00
R5832:Lmo7	UTSW	14	101884213	missense	probably damaging	1.00
R5966:Lmo7	UTSW	14	101900502	missense	possibly damaging	0.92
R6026:Lmo7	UTSW	14	101880990	missense	probably benign	0.04
R6072:Lmo7	UTSW	14	101929336	utr 3 prime	probably benign
R6158:Lmo7	UTSW	14	101900137	missense	probably benign	0.03
R6246:Lmo7	UTSW	14	101918700	missense	probably damaging	1.00
R6335:Lmo7	UTSW	14	101900636	missense	probably damaging	1.00
R6620:Lmo7	UTSW	14	101875452	missense	probably benign	0.29
R6658:Lmo7	UTSW	14	101910845	missense	possibly damaging	0.84
R6917:Lmo7	UTSW	14	101918010	missense	probably damaging	1.00
R7064:Lmo7	UTSW	14	101884179	missense	probably damaging	1.00
R7072:Lmo7	UTSW	14	101898700	critical splice donor site	probably null
R7121:Lmo7	UTSW	14	101887035	missense	probably damaging	1.00
R7136:Lmo7	UTSW	14	101920539	missense	unknown
R7196:Lmo7	UTSW	14	101896500	missense	possibly damaging	0.75
R7228:Lmo7	UTSW	14	101896535	missense	probably damaging	0.99
R7337:Lmo7	UTSW	14	101884204	missense	probably damaging	0.98
R7341:Lmo7	UTSW	14	101885512	missense	probably benign	0.30
R7408:Lmo7	UTSW	14	101880953	missense	probably damaging	1.00
R7432:Lmo7	UTSW	14	101902115	missense	probably benign	0.42
R7470:Lmo7	UTSW	14	101900604	missense	possibly damaging	0.83
R7506:Lmo7	UTSW	14	101919609	missense	unknown
R7559:Lmo7	UTSW	14	101887226	nonsense	probably null
R7565:Lmo7	UTSW	14	101885301	missense	probably damaging	0.98
R7788:Lmo7	UTSW	14	101898576	missense	possibly damaging	0.64
R8095:Lmo7	UTSW	14	101887419	missense	possibly damaging	0.88
R8100:Lmo7	UTSW	14	101900463	missense	probably benign	0.33
R8121:Lmo7	UTSW	14	101926300	missense	unknown
R8308:Lmo7	UTSW	14	101902371	critical splice donor site	probably null
R8371:Lmo7	UTSW	14	101887008	missense	possibly damaging	0.95
R8403:Lmo7	UTSW	14	101902364	missense	probably benign	0.03
R8690:Lmo7	UTSW	14	101931208	missense	unknown
R8778:Lmo7	UTSW	14	101912067	missense	probably damaging	0.98
R8778:Lmo7	UTSW	14	101919219	missense	probably benign	0.24
R8822:Lmo7	UTSW	14	101884174	missense	probably damaging	1.00
R8849:Lmo7	UTSW	14	101926107	missense	unknown
R8923:Lmo7	UTSW	14	101900243	missense	probably benign	0.31
R9006:Lmo7	UTSW	14	101917636	small deletion	probably benign
R9135:Lmo7	UTSW	14	101880861	missense	probably damaging	1.00
R9154:Lmo7	UTSW	14	101885307	missense	probably damaging	0.99
R9178:Lmo7	UTSW	14	101807470	nonsense	probably null
R9375:Lmo7	UTSW	14	101898687	missense	probably damaging	0.99
R9428:Lmo7	UTSW	14	101917640	missense	probably damaging	0.99
R9488:Lmo7	UTSW	14	101885347	missense	possibly damaging	0.85
R9493:Lmo7	UTSW	14	101900471	missense	probably benign	0.01
R9594:Lmo7	UTSW	14	101918700	missense	probably null	0.98
R9674:Lmo7	UTSW	14	101840904	missense	probably damaging	1.00
R9736:Lmo7	UTSW	14	101920493	missense	unknown
X0066:Lmo7	UTSW	14	101887461	missense	probably damaging	1.00
X0067:Lmo7	UTSW	14	101886933	splice site	probably null
Z1176:Lmo7	UTSW	14	101884306	missense	probably damaging	0.99
Z1176:Lmo7	UTSW	14	101919281	missense	probably benign	0.00
Z1176:Lmo7	UTSW	14	101919443	missense	unknown
Z1176:Lmo7	UTSW	14	101929228	missense	unknown
Z1177:Lmo7	UTSW	14	101896518	missense	possibly damaging	0.96
Z1177:Lmo7	UTSW	14	101898557	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGGACGTGAGATTAGCAAATGCC -3'
(R):5'- ACAGGATGCTGAAGACTGCTGC -3'

Sequencing Primer
(F):5'- CGTGAGATTAGCAAATGCCTATAGC -3'
(R):5'- gctcagaatgctgacccac -3'

Posted On

2013-11-18