Mutagenetix > Incidental Mutation

Incidental Mutation 'R1078:Gtse1'

85753

Institutional Source

Beutler Lab

Gene Symbol

Gtse1

Ensembl Gene

ENSMUSG00000022385

Gene Name

G two S phase expressed protein 1

Synonyms

B99, Gtse-1

MMRRC Submission

039164-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R1078 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85859745-85876573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 85862307 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 108 (P108L)

Ref Sequence

ENSEMBL: ENSMUSP00000155552 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000146088] [ENSMUST00000170629] [ENSMUST00000231074]

AlphaFold

Q8R080

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133158

Predicted Effect

probably benign
Transcript: ENSMUST00000146088

SMART Domains

Protein: ENSMUSP00000114504
Gene: ENSMUSG00000035944

Domain	Start	End	E-Value	Type
SCOP:d1ld8a_	105	272	1e-7	SMART
low complexity region	342	354	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170629
AA Change: P108L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128759
Gene: ENSMUSG00000022385
AA Change: P108L

Domain	Start	End	E-Value	Type
Pfam:GTSE1_N	10	153	3e-62	PFAM
low complexity region	284	301	N/A	INTRINSIC
low complexity region	310	321	N/A	INTRINSIC
low complexity region	360	372	N/A	INTRINSIC
low complexity region	478	497	N/A	INTRINSIC
low complexity region	568	593	N/A	INTRINSIC
low complexity region	644	653	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000231074
AA Change: P108L

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

Meta Mutation Damage Score

0.1994

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.4%
20x: 94.4%

Validation Efficiency

96% (53/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is only expressed in the S and G2 phases of the cell cycle, where it colocalizes with cytoplasmic tubulin and microtubules. In response to DNA damage, the encoded protein accumulates in the nucleus and binds the tumor suppressor protein p53, shuttling it out of the nucleus and repressing its ability to induce apoptosis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,611,762	I358S	probably benign	Het
9130230L23Rik	T	C	5: 65,988,355	T138A	unknown	Het
Abi3bp	T	C	16: 56,654,081		probably null	Het
Alpk3	A	T	7: 81,078,600	M493L	probably benign	Het
Bace2	C	T	16: 97,356,860	A20V	unknown	Het
Bms1	T	C	6: 118,405,221	D452G	probably benign	Het
Ccdc187	T	C	2: 26,294,377	T3A	probably damaging	Het
Ctu2	T	C	8: 122,481,499	V95A	possibly damaging	Het
Cyp2a5	A	G	7: 26,835,541	K60E	probably benign	Het
Cyp4f13	T	C	17: 32,925,568	H318R	probably damaging	Het
Dlgap5	G	A	14: 47,399,566	T485M	probably damaging	Het
Dsp	C	T	13: 38,183,106		probably benign	Het
Ell2	T	C	13: 75,746,419		probably benign	Het
Eml2	A	T	7: 19,179,762	Y168F	probably benign	Het
Ep400	C	T	5: 110,735,522		probably benign	Het
Ercc4	C	A	16: 13,130,197	A336D	probably benign	Het
Fam189a2	T	A	19: 23,973,575	R547S	probably benign	Het
Fat4	T	C	3: 38,983,086	L3629S	probably benign	Het
Gabbr2	C	T	4: 46,664,833	R925H	probably damaging	Het
Gfi1b	A	T	2: 28,613,865	W108R	probably damaging	Het
Hfm1	A	T	5: 106,878,830	F140I	probably damaging	Het
Hyal2	T	A	9: 107,572,246	H400Q	probably benign	Het
Igfn1	A	G	1: 135,974,847	Y371H	probably damaging	Het
Iltifb	T	G	10: 118,290,151	*180C	probably null	Het
Kdm2b	T	C	5: 122,961,541	T118A	possibly damaging	Het
Lama5	A	T	2: 180,179,764		probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lmo7	C	T	14: 101,920,474		probably benign	Het
Lrrc37a	G	T	11: 103,497,631	P2323T	unknown	Het
Lrrc38	A	G	4: 143,350,518	Y117C	probably benign	Het
Myo1e	T	C	9: 70,383,999	V1024A	probably benign	Het
Myrfl	T	C	10: 116,776,732	N904S	possibly damaging	Het
Olfr1015	T	C	2: 85,786,093	V194A	possibly damaging	Het
Olfr103	T	A	17: 37,337,026	I69F	probably damaging	Het
Olfr1297	T	C	2: 111,621,345	H243R	probably damaging	Het
Pld4	A	T	12: 112,763,442	I53F	probably benign	Het
Plekhg4	T	A	8: 105,381,677	C1117*	probably null	Het
Prss39	G	A	1: 34,502,086	E224K	probably benign	Het
Psme1	G	T	14: 55,580,650	G149V	probably damaging	Het
Soat2	T	A	15: 102,153,138		probably null	Het
Stab2	C	T	10: 86,907,133		probably null	Het
Tcf7l2	A	G	19: 55,743,195	T127A	probably benign	Het
Tcp1	T	C	17: 12,923,204		probably benign	Het
Thbs4	G	A	13: 92,762,926		probably benign	Het
Tmf1	T	C	6: 97,173,300	D482G	probably damaging	Het
Trim66	G	T	7: 109,472,319	P591H	probably damaging	Het
Umodl1	T	C	17: 30,959,373	S108P	probably benign	Het
Unc79	T	G	12: 103,074,853	M715R	probably benign	Het
Usp34	C	A	11: 23,433,175		probably benign	Het
Utrn	T	G	10: 12,455,566		probably null	Het
Zfp830	T	C	11: 82,765,339		probably null	Het

Other mutations in Gtse1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Gtse1	APN	15	85868817	missense	possibly damaging	0.54
IGL01344:Gtse1	APN	15	85862066	critical splice acceptor site	probably null
IGL01541:Gtse1	APN	15	85875654	nonsense	probably null
IGL01621:Gtse1	APN	15	85875082	missense	probably benign	0.01
IGL01945:Gtse1	APN	15	85871547	missense	probably benign	0.00
IGL02193:Gtse1	APN	15	85862330	missense	probably benign	0.27
IGL02215:Gtse1	APN	15	85862598	missense	possibly damaging	0.92
IGL02494:Gtse1	APN	15	85867503	missense	probably damaging	1.00
IGL02879:Gtse1	APN	15	85869063	splice site	probably benign
R0009:Gtse1	UTSW	15	85862435	missense	probably benign	0.06
R0047:Gtse1	UTSW	15	85862378	missense	probably damaging	1.00
R0047:Gtse1	UTSW	15	85862378	missense	probably damaging	1.00
R0576:Gtse1	UTSW	15	85869051	missense	probably damaging	1.00
R1442:Gtse1	UTSW	15	85860102	splice site	probably benign
R1623:Gtse1	UTSW	15	85867578	missense	probably benign
R1925:Gtse1	UTSW	15	85873738	missense	probably benign	0.00
R1928:Gtse1	UTSW	15	85862063	splice site	probably benign
R4565:Gtse1	UTSW	15	85875184	missense	probably damaging	0.99
R5170:Gtse1	UTSW	15	85864264	critical splice donor site	probably null
R5310:Gtse1	UTSW	15	85873792	missense	probably benign	0.04
R5428:Gtse1	UTSW	15	85862139	missense	probably benign	0.12
R5748:Gtse1	UTSW	15	85867577	missense	probably benign
R5996:Gtse1	UTSW	15	85864180	missense	probably benign	0.00
R6179:Gtse1	UTSW	15	85868957	missense	possibly damaging	0.95
R6379:Gtse1	UTSW	15	85864224	missense	probably benign	0.01
R6381:Gtse1	UTSW	15	85862148	missense	probably benign	0.00
R6434:Gtse1	UTSW	15	85875169	missense	probably benign	0.21
R7086:Gtse1	UTSW	15	85875549	missense	probably damaging	1.00
R7304:Gtse1	UTSW	15	85871547	missense	probably benign	0.00
R7485:Gtse1	UTSW	15	85868700	missense	probably benign	0.04
R7580:Gtse1	UTSW	15	85862231	missense	probably damaging	1.00
R7856:Gtse1	UTSW	15	85864141	missense	probably benign	0.09
R8496:Gtse1	UTSW	15	85862082	missense	probably damaging	1.00
R8674:Gtse1	UTSW	15	85862175	missense	probably damaging	1.00
R8987:Gtse1	UTSW	15	85868908	missense	probably benign	0.00
R9491:Gtse1	UTSW	15	85871533	missense	probably damaging	1.00
R9642:Gtse1	UTSW	15	85867496	missense	probably damaging	0.98
Z1176:Gtse1	UTSW	15	85868746	missense	possibly damaging	0.85
Z1177:Gtse1	UTSW	15	85875737	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGACAGGTTCATCAAAGCCCCTCG -3'
(R):5'- GCCAGGTGAAGGTTTCTTCCTCTC -3'

Sequencing Primer
(F):5'- AAGCCCCTCGCCTAGATG -3'
(R):5'- ACTTGATTCTCTTGGCAACGG -3'

Posted On

2013-11-18