Incidental Mutation 'R1078:Ercc4'
ID85755
Institutional Source Beutler Lab
Gene Symbol Ercc4
Ensembl Gene ENSMUSG00000022545
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 4
SynonymsXpf
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1078 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location13109684-13150617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 13130197 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 336 (A336D)
Ref Sequence ENSEMBL: ENSMUSP00000114639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023206] [ENSMUST00000129049] [ENSMUST00000141024]
Predicted Effect probably benign
Transcript: ENSMUST00000023206
AA Change: A426D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023206
Gene: ENSMUSG00000022545
AA Change: A426D

DomainStartEndE-ValueType
Blast:DEXDc 8 187 1e-5 BLAST
ERCC4 684 764 1.11e-26 SMART
low complexity region 789 802 N/A INTRINSIC
PDB:2AQ0|B 835 917 6e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000129049
AA Change: A336D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000141024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156393
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a complex with ERCC1 and is involved in the 5' incision made during nucleotide excision repair. This complex is a structure specific DNA repair endonuclease that interacts with EME1. Defects in this gene are a cause of xeroderma pigmentosum complementation group F (XP-F), or xeroderma pigmentosum VI (XP6).[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice show impaired growth and do not survive longer than several weeks of age. Cultutred cells obtained from mutant mice were shown to be hypersensitive to UV irradiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Ercc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Ercc4 APN 16 13125369 missense possibly damaging 0.91
IGL00805:Ercc4 APN 16 13122004 missense possibly damaging 0.77
IGL01348:Ercc4 APN 16 13132934 missense probably damaging 1.00
IGL02406:Ercc4 APN 16 13123536 missense probably damaging 1.00
IGL03248:Ercc4 APN 16 13127593 missense probably damaging 1.00
Rascal UTSW 16 13132947 missense probably damaging 1.00
PIT4812001:Ercc4 UTSW 16 13144447 missense probably benign 0.29
R0212:Ercc4 UTSW 16 13123332 critical splice acceptor site probably null
R0505:Ercc4 UTSW 16 13126467 missense probably benign
R0962:Ercc4 UTSW 16 13130146 missense probably damaging 0.99
R1356:Ercc4 UTSW 16 13125282 missense probably damaging 0.99
R1420:Ercc4 UTSW 16 13130209 missense probably benign 0.01
R1554:Ercc4 UTSW 16 13147622 missense probably damaging 1.00
R1899:Ercc4 UTSW 16 13147787 missense probably damaging 1.00
R2128:Ercc4 UTSW 16 13147934 missense probably damaging 0.99
R2214:Ercc4 UTSW 16 13110024 missense probably damaging 1.00
R3757:Ercc4 UTSW 16 13144496 missense probably benign 0.28
R4072:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4073:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4075:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4076:Ercc4 UTSW 16 13130685 missense probably damaging 1.00
R4646:Ercc4 UTSW 16 13147574 missense probably damaging 1.00
R4731:Ercc4 UTSW 16 13147607 missense probably damaging 1.00
R4756:Ercc4 UTSW 16 13123423 missense probably damaging 1.00
R4767:Ercc4 UTSW 16 13122095 missense probably damaging 1.00
R5011:Ercc4 UTSW 16 13123581 intron probably benign
R5013:Ercc4 UTSW 16 13123581 intron probably benign
R5301:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R5308:Ercc4 UTSW 16 13130164 missense probably damaging 1.00
R5684:Ercc4 UTSW 16 13130601 missense probably benign 0.35
R6083:Ercc4 UTSW 16 13110039 nonsense probably null
R6092:Ercc4 UTSW 16 13125261 missense probably benign 0.04
R6815:Ercc4 UTSW 16 13123435 missense probably damaging 0.99
R6953:Ercc4 UTSW 16 13130686 missense probably damaging 1.00
R7062:Ercc4 UTSW 16 13132947 missense probably damaging 1.00
R7199:Ercc4 UTSW 16 13147793 missense probably damaging 1.00
R7317:Ercc4 UTSW 16 13122113 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- AGGTGAAAGCATGTGGTTGCTCC -3'
(R):5'- CCCCAAAACTTGCGTCAGAGTCAG -3'

Sequencing Primer
(F):5'- ATGTGGTTGCTCCCCAAAC -3'
(R):5'- GCGTCAGAGTCAGCTCTTG -3'
Posted On2013-11-18