Mutagenetix > Incidental Mutations

Incidental Mutation 'R1078:Abi3bp'

85756

Institutional Source

Beutler Lab

Gene Symbol

Abi3bp

Ensembl Gene

ENSMUSG00000035258

Gene Name

ABI gene family, member 3 (NESH) binding protein

Synonyms

D930038M13Rik, eratin, TARSH, 5033411B22Rik

MMRRC Submission

039164-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R1078 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56477878-56690135 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 56654081 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000156180 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048471] [ENSMUST00000096012] [ENSMUST00000096013] [ENSMUST00000171000] [ENSMUST00000231781] [ENSMUST00000231832] [ENSMUST00000231870]

AlphaFold

A0A338P6S8

Predicted Effect

probably null
Transcript: ENSMUST00000048471

SMART Domains

Protein: ENSMUSP00000036257
Gene: ENSMUSG00000035258

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	433	446	N/A	INTRINSIC
low complexity region	516	528	N/A	INTRINSIC
low complexity region	579	591	N/A	INTRINSIC
low complexity region	734	747	N/A	INTRINSIC
low complexity region	751	764	N/A	INTRINSIC
FN3	941	1024	6.29e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000096012

SMART Domains

Protein: ENSMUSP00000093711
Gene: ENSMUSG00000035258

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	433	446	N/A	INTRINSIC
low complexity region	634	647	N/A	INTRINSIC
low complexity region	651	664	N/A	INTRINSIC
FN3	841	924	6.29e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000096013

SMART Domains

Protein: ENSMUSP00000093712
Gene: ENSMUSG00000035258

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	433	446	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
low complexity region	687	700	N/A	INTRINSIC
FN3	877	960	6.29e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000171000

SMART Domains

Protein: ENSMUSP00000128818
Gene: ENSMUSG00000035258

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
FN3	114	203	3.08e-2	SMART
low complexity region	464	477	N/A	INTRINSIC
low complexity region	481	494	N/A	INTRINSIC
FN3	671	754	6.29e-8	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000231781

Predicted Effect

probably null
Transcript: ENSMUST00000231832

Predicted Effect

probably null
Transcript: ENSMUST00000231870

Meta Mutation Damage Score

0.9492

Coding Region Coverage

1x: 99.7%
3x: 99.1%
10x: 97.4%
20x: 94.4%

Validation Efficiency

96% (53/55)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,611,762	I358S	probably benign	Het
9130230L23Rik	T	C	5: 65,988,355	T138A	unknown	Het
Alpk3	A	T	7: 81,078,600	M493L	probably benign	Het
Bace2	C	T	16: 97,356,860	A20V	unknown	Het
Bms1	T	C	6: 118,405,221	D452G	probably benign	Het
Ccdc187	T	C	2: 26,294,377	T3A	probably damaging	Het
Ctu2	T	C	8: 122,481,499	V95A	possibly damaging	Het
Cyp2a5	A	G	7: 26,835,541	K60E	probably benign	Het
Cyp4f13	T	C	17: 32,925,568	H318R	probably damaging	Het
Dlgap5	G	A	14: 47,399,566	T485M	probably damaging	Het
Dsp	C	T	13: 38,183,106		probably benign	Het
Ell2	T	C	13: 75,746,419		probably benign	Het
Eml2	A	T	7: 19,179,762	Y168F	probably benign	Het
Ep400	C	T	5: 110,735,522		probably benign	Het
Ercc4	C	A	16: 13,130,197	A336D	probably benign	Het
Fam189a2	T	A	19: 23,973,575	R547S	probably benign	Het
Fat4	T	C	3: 38,983,086	L3629S	probably benign	Het
Gabbr2	C	T	4: 46,664,833	R925H	probably damaging	Het
Gfi1b	A	T	2: 28,613,865	W108R	probably damaging	Het
Gtse1	C	T	15: 85,862,307	P108L	probably damaging	Het
Hfm1	A	T	5: 106,878,830	F140I	probably damaging	Het
Hyal2	T	A	9: 107,572,246	H400Q	probably benign	Het
Igfn1	A	G	1: 135,974,847	Y371H	probably damaging	Het
Iltifb	T	G	10: 118,290,151	*180C	probably null	Het
Kdm2b	T	C	5: 122,961,541	T118A	possibly damaging	Het
Lama5	A	T	2: 180,179,764		probably benign	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lmo7	C	T	14: 101,920,474		probably benign	Het
Lrrc37a	G	T	11: 103,497,631	P2323T	unknown	Het
Lrrc38	A	G	4: 143,350,518	Y117C	probably benign	Het
Myo1e	T	C	9: 70,383,999	V1024A	probably benign	Het
Myrfl	T	C	10: 116,776,732	N904S	possibly damaging	Het
Olfr1015	T	C	2: 85,786,093	V194A	possibly damaging	Het
Olfr103	T	A	17: 37,337,026	I69F	probably damaging	Het
Olfr1297	T	C	2: 111,621,345	H243R	probably damaging	Het
Pld4	A	T	12: 112,763,442	I53F	probably benign	Het
Plekhg4	T	A	8: 105,381,677	C1117*	probably null	Het
Prss39	G	A	1: 34,502,086	E224K	probably benign	Het
Psme1	G	T	14: 55,580,650	G149V	probably damaging	Het
Soat2	T	A	15: 102,153,138		probably null	Het
Stab2	C	T	10: 86,907,133		probably null	Het
Tcf7l2	A	G	19: 55,743,195	T127A	probably benign	Het
Tcp1	T	C	17: 12,923,204		probably benign	Het
Thbs4	G	A	13: 92,762,926		probably benign	Het
Tmf1	T	C	6: 97,173,300	D482G	probably damaging	Het
Trim66	G	T	7: 109,472,319	P591H	probably damaging	Het
Umodl1	T	C	17: 30,959,373	S108P	probably benign	Het
Unc79	T	G	12: 103,074,853	M715R	probably benign	Het
Usp34	C	A	11: 23,433,175		probably benign	Het
Utrn	T	G	10: 12,455,566		probably null	Het
Zfp830	T	C	11: 82,765,339		probably null	Het

Other mutations in Abi3bp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Abi3bp	APN	16	56602805	missense	probably null	0.99
IGL01580:Abi3bp	APN	16	56675210	missense	probably damaging	1.00
IGL01633:Abi3bp	APN	16	56677800	missense	probably damaging	1.00
IGL01783:Abi3bp	APN	16	56532969	critical splice donor site	probably null
IGL01866:Abi3bp	APN	16	56671973	missense	probably benign	0.19
IGL02022:Abi3bp	APN	16	56592636	missense	probably damaging	1.00
IGL02086:Abi3bp	APN	16	56642567	splice site	probably benign
IGL02122:Abi3bp	APN	16	56687128	splice site	probably benign
IGL02155:Abi3bp	APN	16	56587964	missense	probably damaging	0.99
IGL02351:Abi3bp	APN	16	56654055	missense	possibly damaging	0.91
IGL02358:Abi3bp	APN	16	56654055	missense	possibly damaging	0.91
IGL02418:Abi3bp	APN	16	56604116	splice site	probably benign
IGL02559:Abi3bp	APN	16	56687070	nonsense	probably null
IGL02617:Abi3bp	APN	16	56574444	nonsense	probably null
IGL02810:Abi3bp	APN	16	56677775	missense	probably damaging	1.00
IGL03057:Abi3bp	APN	16	56668391	missense	possibly damaging	0.95
IGL03174:Abi3bp	APN	16	56614747	missense	possibly damaging	0.64
R0389:Abi3bp	UTSW	16	56671307	missense	possibly damaging	0.79
R0485:Abi3bp	UTSW	16	56604012	splice site	probably null
R0557:Abi3bp	UTSW	16	56668387	missense	probably damaging	0.97
R0616:Abi3bp	UTSW	16	56654070	missense	probably damaging	0.99
R0685:Abi3bp	UTSW	16	56532953	missense	possibly damaging	0.90
R0783:Abi3bp	UTSW	16	56595238	critical splice acceptor site	probably null
R0828:Abi3bp	UTSW	16	56677830	missense	probably damaging	1.00
R0841:Abi3bp	UTSW	16	56668276	missense	possibly damaging	0.95
R1101:Abi3bp	UTSW	16	56606158	missense	probably damaging	1.00
R1116:Abi3bp	UTSW	16	56686429	splice site	probably benign
R1145:Abi3bp	UTSW	16	56668276	missense	possibly damaging	0.95
R1145:Abi3bp	UTSW	16	56668276	missense	possibly damaging	0.95
R1317:Abi3bp	UTSW	16	56668309	missense	possibly damaging	0.79
R1384:Abi3bp	UTSW	16	56574499	missense	probably damaging	1.00
R1460:Abi3bp	UTSW	16	56562417	missense	probably damaging	0.99
R1730:Abi3bp	UTSW	16	56668279	missense	possibly damaging	0.62
R1761:Abi3bp	UTSW	16	56668309	missense	possibly damaging	0.79
R1830:Abi3bp	UTSW	16	56587985	missense	probably damaging	1.00
R1873:Abi3bp	UTSW	16	56574499	missense	probably damaging	1.00
R1875:Abi3bp	UTSW	16	56574499	missense	probably damaging	1.00
R1996:Abi3bp	UTSW	16	56671357	missense	possibly damaging	0.61
R2018:Abi3bp	UTSW	16	56677796	missense	probably damaging	1.00
R2019:Abi3bp	UTSW	16	56677796	missense	probably damaging	1.00
R2035:Abi3bp	UTSW	16	56660218	missense	probably benign	0.21
R2118:Abi3bp	UTSW	16	56477864	unclassified	probably benign
R2202:Abi3bp	UTSW	16	56613203	missense	probably benign	0.06
R2202:Abi3bp	UTSW	16	56650725	nonsense	probably null
R2203:Abi3bp	UTSW	16	56613203	missense	probably benign	0.06
R3030:Abi3bp	UTSW	16	56657319	missense	possibly damaging	0.79
R3952:Abi3bp	UTSW	16	56604038	missense	possibly damaging	0.88
R4176:Abi3bp	UTSW	16	56652200	missense	probably damaging	0.96
R4296:Abi3bp	UTSW	16	56668310	missense	probably benign	0.05
R4301:Abi3bp	UTSW	16	56556903	missense	probably damaging	1.00
R4354:Abi3bp	UTSW	16	56532951	missense	probably benign	0.05
R4417:Abi3bp	UTSW	16	56654035	missense	probably damaging	1.00
R4716:Abi3bp	UTSW	16	56650725	nonsense	probably null
R4808:Abi3bp	UTSW	16	56594516	missense	probably damaging	0.96
R4814:Abi3bp	UTSW	16	56650753	missense	probably benign	0.06
R5016:Abi3bp	UTSW	16	56671268	missense	probably damaging	0.97
R5290:Abi3bp	UTSW	16	56642475	splice site	probably null
R5891:Abi3bp	UTSW	16	56606133	missense	probably damaging	1.00
R5897:Abi3bp	UTSW	16	56604669	missense	possibly damaging	0.53
R6146:Abi3bp	UTSW	16	56671265	missense	probably damaging	0.99
R6267:Abi3bp	UTSW	16	56594497	missense	probably damaging	0.97
R6905:Abi3bp	UTSW	16	56574517	missense	probably damaging	1.00
R6908:Abi3bp	UTSW	16	56657305	missense	probably benign	0.01
R6917:Abi3bp	UTSW	16	56617321	splice site	probably null
R7071:Abi3bp	UTSW	16	56629140	nonsense	probably null
R7194:Abi3bp	UTSW	16	56562371	missense	probably damaging	0.99
R7476:Abi3bp	UTSW	16	56614746	nonsense	probably null
R7554:Abi3bp	UTSW	16	56618212	splice site	probably null
R7571:Abi3bp	UTSW	16	56630982	splice site	probably null
R7661:Abi3bp	UTSW	16	56632900	splice site	probably null
R7662:Abi3bp	UTSW	16	56617323	splice site	probably null
R7910:Abi3bp	UTSW	16	56677742	nonsense	probably null
R8121:Abi3bp	UTSW	16	56631878	missense	unknown
R8781:Abi3bp	UTSW	16	56606149	missense	probably damaging	0.98
R8790:Abi3bp	UTSW	16	56675074	missense	probably damaging	1.00
R8828:Abi3bp	UTSW	16	56687092	missense	probably damaging	1.00
R9094:Abi3bp	UTSW	16	56636227	missense	probably benign	0.00
R9135:Abi3bp	UTSW	16	56596810	missense	probably benign	0.21
R9282:Abi3bp	UTSW	16	56620504	missense	unknown
R9363:Abi3bp	UTSW	16	56618212	splice site	probably null
R9464:Abi3bp	UTSW	16	56588683	missense	possibly damaging	0.48
RF008:Abi3bp	UTSW	16	56627589	intron	probably benign
RF016:Abi3bp	UTSW	16	56627587	frame shift	probably null
RF052:Abi3bp	UTSW	16	56627585	intron	probably benign
RF061:Abi3bp	UTSW	16	56627587	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CTTTCACTCAGTGGCAGGGCAC -3'
(R):5'- ATGGCAGTCAATTTGCCCGAGACC -3'

Sequencing Primer
(F):5'- AAAGATGCCTTGGAAGTCCTTG -3'
(R):5'- TGCCCGAGACCCTTCATC -3'

Posted On

2013-11-18