Incidental Mutation 'R1078:Bace2'
ID 85757
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Name beta-site APP-cleaving enzyme 2
Synonyms ARP1, 1110059C24Rik, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 039164-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.085) question?
Stock # R1078 (G1)
Quality Score 114
Status Validated
Chromosome 16
Chromosomal Location 97157942-97244136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 97158060 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 20 (A20V)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000047275
AA Change: A20V
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: A20V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Meta Mutation Damage Score 0.2217 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik T C 5: 66,145,698 (GRCm39) T138A unknown Het
Abi3bp T C 16: 56,474,444 (GRCm39) probably null Het
Alpk3 A T 7: 80,728,348 (GRCm39) M493L probably benign Het
Bms1 T C 6: 118,382,182 (GRCm39) D452G probably benign Het
Ccdc187 T C 2: 26,184,389 (GRCm39) T3A probably damaging Het
Ctu2 T C 8: 123,208,238 (GRCm39) V95A possibly damaging Het
Cyp2a5 A G 7: 26,534,966 (GRCm39) K60E probably benign Het
Cyp4f13 T C 17: 33,144,542 (GRCm39) H318R probably damaging Het
Dlgap5 G A 14: 47,637,023 (GRCm39) T485M probably damaging Het
Dsp C T 13: 38,367,082 (GRCm39) probably benign Het
Ell2 T C 13: 75,894,538 (GRCm39) probably benign Het
Eml2 A T 7: 18,913,687 (GRCm39) Y168F probably benign Het
Entrep1 T A 19: 23,950,939 (GRCm39) R547S probably benign Het
Ep400 C T 5: 110,883,388 (GRCm39) probably benign Het
Ercc4 C A 16: 12,948,061 (GRCm39) A336D probably benign Het
Fat4 T C 3: 39,037,235 (GRCm39) L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 (GRCm39) R925H probably damaging Het
Gfi1b A T 2: 28,503,877 (GRCm39) W108R probably damaging Het
Gtse1 C T 15: 85,746,508 (GRCm39) P108L probably damaging Het
Hfm1 A T 5: 107,026,696 (GRCm39) F140I probably damaging Het
Hyal2 T A 9: 107,449,445 (GRCm39) H400Q probably benign Het
Igfn1 A G 1: 135,902,585 (GRCm39) Y371H probably damaging Het
Il22b T G 10: 118,126,056 (GRCm39) *180C probably null Het
Kdm2b T C 5: 123,099,604 (GRCm39) T118A possibly damaging Het
Lama5 A T 2: 179,821,557 (GRCm39) probably benign Het
Lgr6 C T 1: 134,921,748 (GRCm39) A199T probably damaging Het
Lmo7 C T 14: 102,157,910 (GRCm39) probably benign Het
Lrrc37a G T 11: 103,388,457 (GRCm39) P2323T unknown Het
Lrrc38 A G 4: 143,077,088 (GRCm39) Y117C probably benign Het
Myo1e T C 9: 70,291,281 (GRCm39) V1024A probably benign Het
Myrfl T C 10: 116,612,637 (GRCm39) N904S possibly damaging Het
Or12d13 T A 17: 37,647,917 (GRCm39) I69F probably damaging Het
Or4k47 T C 2: 111,451,690 (GRCm39) H243R probably damaging Het
Or9g4b T C 2: 85,616,437 (GRCm39) V194A possibly damaging Het
Pld4 A T 12: 112,729,876 (GRCm39) I53F probably benign Het
Plekhg4 T A 8: 106,108,309 (GRCm39) C1117* probably null Het
Prss39 G A 1: 34,541,167 (GRCm39) E224K probably benign Het
Psme1 G T 14: 55,818,107 (GRCm39) G149V probably damaging Het
Sanbr A C 11: 23,561,762 (GRCm39) I358S probably benign Het
Soat2 T A 15: 102,061,573 (GRCm39) probably null Het
Stab2 C T 10: 86,742,997 (GRCm39) probably null Het
Tcf7l2 A G 19: 55,731,627 (GRCm39) T127A probably benign Het
Tcp1 T C 17: 13,142,091 (GRCm39) probably benign Het
Thbs4 G A 13: 92,899,434 (GRCm39) probably benign Het
Tmf1 T C 6: 97,150,261 (GRCm39) D482G probably damaging Het
Trim66 G T 7: 109,071,526 (GRCm39) P591H probably damaging Het
Umodl1 T C 17: 31,178,347 (GRCm39) S108P probably benign Het
Unc79 T G 12: 103,041,112 (GRCm39) M715R probably benign Het
Usp34 C A 11: 23,383,175 (GRCm39) probably benign Het
Utrn T G 10: 12,331,310 (GRCm39) probably null Het
Zfp830 T C 11: 82,656,165 (GRCm39) probably null Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97,209,630 (GRCm39) missense probably damaging 0.97
IGL02660:Bace2 APN 16 97,216,340 (GRCm39) missense probably damaging 1.00
IGL02669:Bace2 APN 16 97,238,093 (GRCm39) makesense probably null
R0244:Bace2 UTSW 16 97,237,973 (GRCm39) splice site probably null
R0674:Bace2 UTSW 16 97,237,949 (GRCm39) missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97,158,141 (GRCm39) missense possibly damaging 0.67
R1670:Bace2 UTSW 16 97,213,335 (GRCm39) missense probably damaging 0.96
R1997:Bace2 UTSW 16 97,216,289 (GRCm39) missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97,213,336 (GRCm39) missense probably damaging 1.00
R2937:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R2938:Bace2 UTSW 16 97,213,388 (GRCm39) critical splice donor site probably null
R3103:Bace2 UTSW 16 97,223,201 (GRCm39) critical splice donor site probably null
R3755:Bace2 UTSW 16 97,237,857 (GRCm39) missense probably benign 0.34
R4110:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4112:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4113:Bace2 UTSW 16 97,237,856 (GRCm39) missense probably benign
R4560:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4562:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4563:Bace2 UTSW 16 97,223,180 (GRCm39) missense probably damaging 1.00
R4717:Bace2 UTSW 16 97,238,073 (GRCm39) missense probably damaging 1.00
R5535:Bace2 UTSW 16 97,214,625 (GRCm39) missense probably damaging 1.00
R6282:Bace2 UTSW 16 97,216,297 (GRCm39) missense probably damaging 1.00
R6364:Bace2 UTSW 16 97,214,633 (GRCm39) missense probably benign 0.05
R7045:Bace2 UTSW 16 97,200,865 (GRCm39) missense probably damaging 1.00
R7241:Bace2 UTSW 16 97,237,998 (GRCm39) missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97,200,882 (GRCm39) missense probably benign 0.01
R7653:Bace2 UTSW 16 97,237,852 (GRCm39) missense
R8026:Bace2 UTSW 16 97,238,052 (GRCm39) missense probably benign 0.26
R8171:Bace2 UTSW 16 97,225,786 (GRCm39) missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97,158,108 (GRCm39) missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97,214,670 (GRCm39) missense probably damaging 1.00
R9205:Bace2 UTSW 16 97,158,059 (GRCm39) missense unknown
R9221:Bace2 UTSW 16 97,209,692 (GRCm39) missense probably benign 0.01
X0024:Bace2 UTSW 16 97,214,598 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAACTTGTTCAACTCTGCACCG -3'
(R):5'- CTTCTTCCCAGTGAAAGCTACTGCC -3'

Sequencing Primer
(F):5'- AACTCTGCACCGCCTTC -3'
(R):5'- CGATCAGCATCTCTAGGTAGTAGC -3'
Posted On 2013-11-18