Incidental Mutation 'R1078:Bace2'
ID85757
Institutional Source Beutler Lab
Gene Symbol Bace2
Ensembl Gene ENSMUSG00000040605
Gene Namebeta-site APP-cleaving enzyme 2
Synonyms1110059C24Rik, ARP1, BAE2, ALP56, ASP21, CDA13, CEAP1
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1078 (G1)
Quality Score114
Status Validated
Chromosome16
Chromosomal Location97356742-97442936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97356860 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 20 (A20V)
Ref Sequence ENSEMBL: ENSMUSP00000043918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047275]
Predicted Effect unknown
Transcript: ENSMUST00000047275
AA Change: A20V
SMART Domains Protein: ENSMUSP00000043918
Gene: ENSMUSG00000040605
AA Change: A20V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Asp 87 427 2.3e-47 PFAM
Pfam:TAXi_C 269 426 4.4e-16 PFAM
transmembrane domain 466 488 N/A INTRINSIC
Meta Mutation Damage Score 0.2217 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein undergoes proteolytic processing to generate an active endopeptidase enzyme. This transmembrane protease catalyzes the proteolysis of amyloid precursor protein to produce amyloid beta peptide. Mice lacking the encoded product exhibit increased pancreatic beta cell mass and improved glucose tolerance due to increased insulin secretion. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in impaired APP processing by neurons and glia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Tcp1 T C 17: 12,923,204 probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Bace2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Bace2 APN 16 97408430 missense probably damaging 0.97
IGL02660:Bace2 APN 16 97415140 missense probably damaging 1.00
IGL02669:Bace2 APN 16 97436893 makesense probably null
R0244:Bace2 UTSW 16 97436773 splice site probably null
R0674:Bace2 UTSW 16 97436749 missense possibly damaging 0.93
R0906:Bace2 UTSW 16 97356941 missense possibly damaging 0.67
R1670:Bace2 UTSW 16 97412135 missense probably damaging 0.96
R1997:Bace2 UTSW 16 97415089 missense possibly damaging 0.93
R2050:Bace2 UTSW 16 97412136 missense probably damaging 1.00
R2937:Bace2 UTSW 16 97412188 critical splice donor site probably null
R2938:Bace2 UTSW 16 97412188 critical splice donor site probably null
R3103:Bace2 UTSW 16 97422001 critical splice donor site probably null
R3755:Bace2 UTSW 16 97436657 missense probably benign 0.34
R4110:Bace2 UTSW 16 97436656 missense probably benign
R4112:Bace2 UTSW 16 97436656 missense probably benign
R4113:Bace2 UTSW 16 97436656 missense probably benign
R4560:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4562:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4563:Bace2 UTSW 16 97421980 missense probably damaging 1.00
R4717:Bace2 UTSW 16 97436873 missense probably damaging 1.00
R5535:Bace2 UTSW 16 97413425 missense probably damaging 1.00
R6282:Bace2 UTSW 16 97415097 missense probably damaging 1.00
R6364:Bace2 UTSW 16 97413433 missense probably benign 0.05
R7045:Bace2 UTSW 16 97399665 missense probably damaging 1.00
R7241:Bace2 UTSW 16 97436798 missense possibly damaging 0.92
R7546:Bace2 UTSW 16 97399682 missense probably benign 0.01
R7653:Bace2 UTSW 16 97436652 missense
R8026:Bace2 UTSW 16 97436852 missense probably benign 0.26
R8171:Bace2 UTSW 16 97424586 missense possibly damaging 0.86
R8324:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8341:Bace2 UTSW 16 97356908 missense possibly damaging 0.51
R8480:Bace2 UTSW 16 97413470 missense probably damaging 1.00
X0024:Bace2 UTSW 16 97413398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAACTTGTTCAACTCTGCACCG -3'
(R):5'- CTTCTTCCCAGTGAAAGCTACTGCC -3'

Sequencing Primer
(F):5'- AACTCTGCACCGCCTTC -3'
(R):5'- CGATCAGCATCTCTAGGTAGTAGC -3'
Posted On2013-11-18