Incidental Mutation 'R1078:Tcp1'
ID85758
Institutional Source Beutler Lab
Gene Symbol Tcp1
Ensembl Gene ENSMUSG00000068039
Gene Namet-complex protein 1
Synonymsp63, CCT, Ccta, Cct1, c-cpn, Tp63, Tcp-1, TRic
MMRRC Submission 039164-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R1078 (G1)
Quality Score214
Status Validated
Chromosome17
Chromosomal Location12915701-12925067 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 12923204 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043923] [ENSMUST00000089024] [ENSMUST00000143961] [ENSMUST00000151287] [ENSMUST00000160378]
Predicted Effect probably benign
Transcript: ENSMUST00000043923
SMART Domains Protein: ENSMUSP00000045912
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 8 267 2.9e-97 PFAM
Pfam:Thiolase_C 274 396 1.3e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083171
Predicted Effect probably benign
Transcript: ENSMUST00000089024
SMART Domains Protein: ENSMUSP00000086418
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 1 486 1.9e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138709
Predicted Effect probably benign
Transcript: ENSMUST00000143961
SMART Domains Protein: ENSMUSP00000116511
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 103 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151287
SMART Domains Protein: ENSMUSP00000116108
Gene: ENSMUSG00000068039

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 28 535 6.3e-156 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151715
Predicted Effect probably benign
Transcript: ENSMUST00000160378
SMART Domains Protein: ENSMUSP00000125454
Gene: ENSMUSG00000062480

DomainStartEndE-ValueType
Pfam:Thiolase_N 5 248 5.6e-91 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160921
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.4%
  • 20x: 94.4%
Validation Efficiency 96% (53/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found. [provided by RefSeq, Jun 2010]
PHENOTYPE: There are two electrophoretic alleles known; allele a occurs in all complete t haplotype chromosomes and allele b in wild-type strains. There are multiple changes between the amino acid sequences of the TCP1A and TCP1B proteins encoded by the two alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,611,762 I358S probably benign Het
9130230L23Rik T C 5: 65,988,355 T138A unknown Het
Abi3bp T C 16: 56,654,081 probably null Het
Alpk3 A T 7: 81,078,600 M493L probably benign Het
Bace2 C T 16: 97,356,860 A20V unknown Het
Bms1 T C 6: 118,405,221 D452G probably benign Het
Ccdc187 T C 2: 26,294,377 T3A probably damaging Het
Ctu2 T C 8: 122,481,499 V95A possibly damaging Het
Cyp2a5 A G 7: 26,835,541 K60E probably benign Het
Cyp4f13 T C 17: 32,925,568 H318R probably damaging Het
Dlgap5 G A 14: 47,399,566 T485M probably damaging Het
Dsp C T 13: 38,183,106 probably benign Het
Ell2 T C 13: 75,746,419 probably benign Het
Eml2 A T 7: 19,179,762 Y168F probably benign Het
Ep400 C T 5: 110,735,522 probably benign Het
Ercc4 C A 16: 13,130,197 A336D probably benign Het
Fam189a2 T A 19: 23,973,575 R547S probably benign Het
Fat4 T C 3: 38,983,086 L3629S probably benign Het
Gabbr2 C T 4: 46,664,833 R925H probably damaging Het
Gfi1b A T 2: 28,613,865 W108R probably damaging Het
Gtse1 C T 15: 85,862,307 P108L probably damaging Het
Hfm1 A T 5: 106,878,830 F140I probably damaging Het
Hyal2 T A 9: 107,572,246 H400Q probably benign Het
Igfn1 A G 1: 135,974,847 Y371H probably damaging Het
Iltifb T G 10: 118,290,151 *180C probably null Het
Kdm2b T C 5: 122,961,541 T118A possibly damaging Het
Lama5 A T 2: 180,179,764 probably benign Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lmo7 C T 14: 101,920,474 probably benign Het
Lrrc37a G T 11: 103,497,631 P2323T unknown Het
Lrrc38 A G 4: 143,350,518 Y117C probably benign Het
Myo1e T C 9: 70,383,999 V1024A probably benign Het
Myrfl T C 10: 116,776,732 N904S possibly damaging Het
Olfr1015 T C 2: 85,786,093 V194A possibly damaging Het
Olfr103 T A 17: 37,337,026 I69F probably damaging Het
Olfr1297 T C 2: 111,621,345 H243R probably damaging Het
Pld4 A T 12: 112,763,442 I53F probably benign Het
Plekhg4 T A 8: 105,381,677 C1117* probably null Het
Prss39 G A 1: 34,502,086 E224K probably benign Het
Psme1 G T 14: 55,580,650 G149V probably damaging Het
Soat2 T A 15: 102,153,138 probably null Het
Stab2 C T 10: 86,907,133 probably null Het
Tcf7l2 A G 19: 55,743,195 T127A probably benign Het
Thbs4 G A 13: 92,762,926 probably benign Het
Tmf1 T C 6: 97,173,300 D482G probably damaging Het
Trim66 G T 7: 109,472,319 P591H probably damaging Het
Umodl1 T C 17: 30,959,373 S108P probably benign Het
Unc79 T G 12: 103,074,853 M715R probably benign Het
Usp34 C A 11: 23,433,175 probably benign Het
Utrn T G 10: 12,455,566 probably null Het
Zfp830 T C 11: 82,765,339 probably null Het
Other mutations in Tcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01624:Tcp1 APN 17 12919925 missense probably benign 0.00
IGL01859:Tcp1 APN 17 12922684 missense possibly damaging 0.95
IGL02635:Tcp1 APN 17 12923409 missense probably benign 0.35
R0164:Tcp1 UTSW 17 12922747 unclassified probably benign
R0308:Tcp1 UTSW 17 12920419 missense probably benign 0.14
R0452:Tcp1 UTSW 17 12924352 missense probably benign 0.14
R0661:Tcp1 UTSW 17 12923313 missense probably benign 0.02
R0674:Tcp1 UTSW 17 12923244 missense probably damaging 1.00
R1434:Tcp1 UTSW 17 12922606 splice site probably null
R1678:Tcp1 UTSW 17 12920423 missense probably benign
R1801:Tcp1 UTSW 17 12922202 nonsense probably null
R2063:Tcp1 UTSW 17 12920812 missense probably damaging 0.99
R4061:Tcp1 UTSW 17 12920863 missense probably benign
R4078:Tcp1 UTSW 17 12918083 missense probably benign 0.05
R5516:Tcp1 UTSW 17 12924334 missense probably damaging 0.98
R5620:Tcp1 UTSW 17 12919337 splice site probably null
R5764:Tcp1 UTSW 17 12916602 missense probably benign 0.10
R6729:Tcp1 UTSW 17 12923253 missense probably damaging 1.00
R7112:Tcp1 UTSW 17 12917873 missense probably damaging 0.99
R7614:Tcp1 UTSW 17 12922653 missense possibly damaging 0.83
R7718:Tcp1 UTSW 17 12922162 missense probably damaging 1.00
R8194:Tcp1 UTSW 17 12922734 critical splice donor site probably null
R8239:Tcp1 UTSW 17 12920851 missense probably benign 0.00
R8781:Tcp1 UTSW 17 12924376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACATTGTTCCTGGTGCCTTATGC -3'
(R):5'- ACCCTATGCCTTTGAAAGCAGCC -3'

Sequencing Primer
(F):5'- cgtgtagccctgactgtcc -3'
(R):5'- TATATGGACAGGGCAGCTTCTAC -3'
Posted On2013-11-18