Incidental Mutation 'R1079:Ikzf2'
ID85765
Institutional Source Beutler Lab
Gene Symbol Ikzf2
Ensembl Gene ENSMUSG00000025997
Gene NameIKAROS family zinc finger 2
SynonymsA730095J18Rik, Zfpn1a2, Helios
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1079 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location69531214-69687245 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69539105 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 341 (D341G)
Ref Sequence ENSEMBL: ENSMUSP00000140043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027146] [ENSMUST00000187184] [ENSMUST00000188110] [ENSMUST00000190771] [ENSMUST00000190855] [ENSMUST00000191262]
Predicted Effect probably benign
Transcript: ENSMUST00000027146
AA Change: D415G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027146
Gene: ENSMUSG00000025997
AA Change: D415G

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 112 134 7.67e-2 SMART
ZnF_C2H2 140 162 1.72e-4 SMART
ZnF_C2H2 168 190 3.95e-4 SMART
ZnF_C2H2 196 219 3.58e-2 SMART
ZnF_C2H2 471 493 9.46e0 SMART
ZnF_C2H2 499 523 6.13e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187100
Predicted Effect possibly damaging
Transcript: ENSMUST00000187184
AA Change: D389G

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141075
Gene: ENSMUSG00000025997
AA Change: D389G

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 1.72e-4 SMART
ZnF_C2H2 142 164 3.95e-4 SMART
ZnF_C2H2 170 193 3.58e-2 SMART
ZnF_C2H2 445 467 9.46e0 SMART
ZnF_C2H2 473 497 6.13e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188110
AA Change: D343G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000140069
Gene: ENSMUSG00000025997
AA Change: D343G

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 7.3e-7 SMART
ZnF_C2H2 142 164 1.6e-6 SMART
ZnF_C2H2 399 421 4e-2 SMART
ZnF_C2H2 427 451 2.6e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190771
AA Change: D421G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000139543
Gene: ENSMUSG00000025997
AA Change: D421G

DomainStartEndE-ValueType
low complexity region 82 95 N/A INTRINSIC
ZnF_C2H2 118 140 3.2e-4 SMART
ZnF_C2H2 146 168 7.3e-7 SMART
ZnF_C2H2 174 196 1.6e-6 SMART
ZnF_C2H2 202 225 1.5e-4 SMART
ZnF_C2H2 477 499 4e-2 SMART
ZnF_C2H2 505 529 2.6e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190855
AA Change: D341G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000140043
Gene: ENSMUSG00000025997
AA Change: D341G

DomainStartEndE-ValueType
low complexity region 76 89 N/A INTRINSIC
ZnF_C2H2 114 136 7.3e-7 SMART
ZnF_C2H2 142 164 1.6e-6 SMART
ZnF_C2H2 170 193 1.5e-4 SMART
ZnF_C2H2 397 419 4e-2 SMART
ZnF_C2H2 425 449 2.6e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191262
AA Change: D270G

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139530
Gene: ENSMUSG00000025997
AA Change: D270G

DomainStartEndE-ValueType
ZnF_C2H2 51 74 1.5e-4 SMART
ZnF_C2H2 326 348 4e-2 SMART
ZnF_C2H2 354 378 2.6e-3 SMART
Meta Mutation Damage Score 0.1073 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ikaros family of zinc-finger proteins. Three members of this protein family (Ikaros, Aiolos and Helios) are hematopoietic-specific transcription factors involved in the regulation of lymphocyte development. This protein forms homo- or hetero-dimers with other Ikaros family members, and is thought to function predominantly in early hematopoietic development. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit postnatal lethality for unknown reasons. Survivors have decreased body weight. Postnatal lethality has complete penetrance on the C57BL/6 strain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Arsa G A 15: 89,474,225 probably benign Het
Baz1a T A 12: 54,895,000 I1474L possibly damaging Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Cryba2 A T 1: 74,890,558 V140E probably damaging Het
Dennd4b G A 3: 90,271,178 R516K probably benign Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Kif3a G C 11: 53,570,581 V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 D246E probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
N6amt1 T C 16: 87,356,198 V52A probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Nudt12 G A 17: 59,011,037 probably benign Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr1151 A G 2: 87,857,355 Y60C probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Pan2 A G 10: 128,318,238 T1050A probably damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in Ikzf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Ikzf2 APN 1 69539322 missense possibly damaging 0.77
IGL01295:Ikzf2 APN 1 69577987 missense probably benign 0.13
IGL01313:Ikzf2 APN 1 69539430 missense probably damaging 0.98
IGL01390:Ikzf2 APN 1 69570642 missense probably damaging 1.00
IGL01862:Ikzf2 APN 1 69538898 missense probably damaging 0.99
Freefall UTSW 1 69539097 nonsense probably null
Wigwam UTSW 1 69577796 nonsense probably null
R1368:Ikzf2 UTSW 1 69539315 missense possibly damaging 0.95
R1661:Ikzf2 UTSW 1 69538814 missense probably damaging 0.99
R1665:Ikzf2 UTSW 1 69538814 missense probably damaging 0.99
R1688:Ikzf2 UTSW 1 69542280 missense possibly damaging 0.77
R1726:Ikzf2 UTSW 1 69548688 missense probably damaging 1.00
R1829:Ikzf2 UTSW 1 69542287 missense probably benign 0.34
R1860:Ikzf2 UTSW 1 69570502 missense probably damaging 1.00
R2507:Ikzf2 UTSW 1 69539288 missense probably benign 0.11
R4457:Ikzf2 UTSW 1 69684188 unclassified probably benign
R5633:Ikzf2 UTSW 1 69539097 nonsense probably null
R5666:Ikzf2 UTSW 1 69577900 missense probably benign 0.04
R5670:Ikzf2 UTSW 1 69577900 missense probably benign 0.04
R5836:Ikzf2 UTSW 1 69539387 missense probably damaging 1.00
R5950:Ikzf2 UTSW 1 69683244 missense probably damaging 1.00
R6492:Ikzf2 UTSW 1 69539042 missense probably damaging 1.00
R6758:Ikzf2 UTSW 1 69538900 missense probably damaging 0.97
R6809:Ikzf2 UTSW 1 69570502 missense probably damaging 1.00
R6946:Ikzf2 UTSW 1 69577796 nonsense probably null
R6959:Ikzf2 UTSW 1 69538770 makesense probably null
R7044:Ikzf2 UTSW 1 69538901 missense possibly damaging 0.93
R7236:Ikzf2 UTSW 1 69539081 missense probably benign 0.00
R7256:Ikzf2 UTSW 1 69578053 intron probably null
R7488:Ikzf2 UTSW 1 69539385 missense probably benign 0.45
X0027:Ikzf2 UTSW 1 69577852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTCACACTTGAAGGCCCTTATC -3'
(R):5'- AATGCAATCACCTACCTTGGAGCTG -3'

Sequencing Primer
(F):5'- ACACTTGAAGGCCCTTATCTGTTC -3'
(R):5'- TGGCCCCAGTTATAAGCTCAG -3'
Posted On2013-11-18