Incidental Mutation 'R1079:Cryba2'
ID85766
Institutional Source Beutler Lab
Gene Symbol Cryba2
Ensembl Gene ENSMUSG00000006546
Gene Namecrystallin, beta A2
SynonymsE130107M19Rik
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R1079 (G1)
Quality Score98
Status Validated
Chromosome1
Chromosomal Location74889934-74893143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 74890558 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 140 (V140E)
Ref Sequence ENSEMBL: ENSMUSP00000006721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006721] [ENSMUST00000133833]
Predicted Effect probably damaging
Transcript: ENSMUST00000006721
AA Change: V140E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006721
Gene: ENSMUSG00000006546
AA Change: V140E

DomainStartEndE-ValueType
XTALbg 13 98 1.64e-37 SMART
XTALbg 107 195 8.79e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133833
SMART Domains Protein: ENSMUSP00000140298
Gene: ENSMUSG00000006546

DomainStartEndE-ValueType
XTALbg 13 54 3.2e-3 SMART
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of the vertebrate eye, which function to maintain the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also defined as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group but absent in the acidic group). Beta-crystallins form aggregates of different sizes and are able to form homodimers through self-association or heterodimers with other beta-crystallins. This gene is a beta acidic group member. Three alternatively spliced transcript variants encoding identical proteins have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for an ENU-induced allele exhibit small lens and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Arsa G A 15: 89,474,225 probably benign Het
Baz1a T A 12: 54,895,000 I1474L possibly damaging Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Dennd4b G A 3: 90,271,178 R516K probably benign Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Ikzf2 T C 1: 69,539,105 D341G possibly damaging Het
Kif3a G C 11: 53,570,581 V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 D246E probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
N6amt1 T C 16: 87,356,198 V52A probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Nudt12 G A 17: 59,011,037 probably benign Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr1151 A G 2: 87,857,355 Y60C probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Pan2 A G 10: 128,318,238 T1050A probably damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in Cryba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02064:Cryba2 APN 1 74890561 missense possibly damaging 0.64
IGL02141:Cryba2 APN 1 74892784 missense probably benign 0.11
P0035:Cryba2 UTSW 1 74890012 missense probably damaging 1.00
R0518:Cryba2 UTSW 1 74890125 missense possibly damaging 0.91
R1317:Cryba2 UTSW 1 74890676 splice site probably null
R4494:Cryba2 UTSW 1 74890630 missense probably damaging 1.00
R4666:Cryba2 UTSW 1 74890048 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTTTTCCAGCTAAGGACAGCCAAC -3'
(R):5'- AGGAGGGCCTGATCTATCCACAAAC -3'

Sequencing Primer
(F):5'- GAGCCTGGTTTCTACATGCAC -3'
(R):5'- CTGATCTATCCACAAACCTCCC -3'
Posted On2013-11-18