Incidental Mutation 'R1079:Cfap65'
ID 85768
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 039165-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.676) question?
Stock # R1079 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 74902071-74935599 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74905713 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1455 (V1455A)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083682
Predicted Effect probably damaging
Transcript: ENSMUST00000094844
AA Change: V1455A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: V1455A

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160540
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 (GRCm38) M1T probably null Het
Adam25 T C 8: 40,755,476 (GRCm38) V593A possibly damaging Het
Agrn C T 4: 156,177,225 (GRCm38) C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 (GRCm38) M158T probably benign Het
Arsa G A 15: 89,474,225 (GRCm38) probably benign Het
Baz1a T A 12: 54,895,000 (GRCm38) I1474L possibly damaging Het
Cfap144 A G 11: 58,801,794 (GRCm38) Y36H probably benign Het
Cnot6 G T 11: 49,685,103 (GRCm38) D176E probably benign Het
Crot A T 5: 8,993,504 (GRCm38) probably null Het
Cryba2 A T 1: 74,890,558 (GRCm38) V140E probably damaging Het
Dennd4b G A 3: 90,271,178 (GRCm38) R516K probably benign Het
Dst C A 1: 34,186,863 (GRCm38) T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 (GRCm38) Y837* probably null Het
Evpl G T 11: 116,230,068 (GRCm38) T447K possibly damaging Het
Fndc3a A T 14: 72,589,807 (GRCm38) M146K possibly damaging Het
Folh1 G T 7: 86,771,881 (GRCm38) T80K probably damaging Het
Gm4922 T A 10: 18,784,338 (GRCm38) Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 (GRCm38) probably benign Het
Hipk3 A G 2: 104,471,698 (GRCm38) F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 (GRCm38) T244S probably benign Het
Ikzf2 T C 1: 69,539,105 (GRCm38) D341G possibly damaging Het
Kif3a G C 11: 53,570,581 (GRCm38) V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 (GRCm38) A199T probably damaging Het
Lzts2 T A 19: 45,023,544 (GRCm38) N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 (GRCm38) D246E probably damaging Het
Myh14 T C 7: 44,630,002 (GRCm38) E918G probably damaging Het
N6amt1 T C 16: 87,356,198 (GRCm38) V52A probably damaging Het
Npr2 A C 4: 43,643,654 (GRCm38) T561P probably damaging Het
Nudt12 G A 17: 59,011,037 (GRCm38) probably benign Het
Or10ad1 A C 15: 98,208,342 (GRCm38) V14G probably damaging Het
Or5w8 A G 2: 87,857,355 (GRCm38) Y60C probably damaging Het
Or6n2 A T 1: 174,069,466 (GRCm38) H56L possibly damaging Het
Or8k22 T A 2: 86,332,841 (GRCm38) R172W probably damaging Het
Pan2 A G 10: 128,318,238 (GRCm38) T1050A probably damaging Het
Rad17 G T 13: 100,633,899 (GRCm38) D213E probably benign Het
Sall2 T A 14: 52,313,203 (GRCm38) H843L probably benign Het
Sdk2 C T 11: 113,838,646 (GRCm38) silent Het
Sema3e A T 5: 14,225,655 (GRCm38) N258I probably benign Het
Siglec1 G A 2: 131,079,377 (GRCm38) R625* probably null Het
Slc15a3 T C 19: 10,855,980 (GRCm38) S454P probably benign Het
Sp110 G A 1: 85,589,104 (GRCm38) probably benign Het
Spatc1l T C 10: 76,563,907 (GRCm38) S88P probably damaging Het
Ssh3 A C 19: 4,266,549 (GRCm38) L143R probably damaging Het
Ttn C T 2: 76,756,996 (GRCm38) probably benign Het
Vps35 A G 8: 85,279,054 (GRCm38) L306S probably damaging Het
Zfp729a T C 13: 67,619,675 (GRCm38) I812V possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,919,183 (GRCm38) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,911,078 (GRCm38) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,927,194 (GRCm38) missense probably benign
IGL01780:Cfap65 APN 1 74,928,348 (GRCm38) nonsense probably null
IGL01993:Cfap65 APN 1 74,920,543 (GRCm38) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,928,145 (GRCm38) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,928,348 (GRCm38) nonsense probably null
IGL02357:Cfap65 APN 1 74,928,348 (GRCm38) nonsense probably null
IGL02576:Cfap65 APN 1 74,903,458 (GRCm38) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,905,080 (GRCm38) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,927,178 (GRCm38) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,911,108 (GRCm38) nonsense probably null
IGL03101:Cfap65 APN 1 74,928,433 (GRCm38) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,927,619 (GRCm38) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,904,642 (GRCm38) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,928,342 (GRCm38) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,931,918 (GRCm38) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,931,958 (GRCm38) nonsense probably null
R0281:Cfap65 UTSW 1 74,927,071 (GRCm38) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,904,067 (GRCm38) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,929,302 (GRCm38) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,929,301 (GRCm38) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,926,444 (GRCm38) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,920,601 (GRCm38) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,925,440 (GRCm38) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,916,884 (GRCm38) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,918,444 (GRCm38) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,902,169 (GRCm38) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,918,887 (GRCm38) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,904,682 (GRCm38) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,921,519 (GRCm38) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,902,447 (GRCm38) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,918,504 (GRCm38) splice site probably benign
R1159:Cfap65 UTSW 1 74,929,340 (GRCm38) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,925,104 (GRCm38) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,917,175 (GRCm38) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,918,948 (GRCm38) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,907,660 (GRCm38) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,917,199 (GRCm38) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,907,691 (GRCm38) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,917,273 (GRCm38) frame shift probably null
R2219:Cfap65 UTSW 1 74,904,025 (GRCm38) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,904,025 (GRCm38) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,926,475 (GRCm38) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,927,186 (GRCm38) small insertion probably benign
R3114:Cfap65 UTSW 1 74,927,132 (GRCm38) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,920,542 (GRCm38) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,927,681 (GRCm38) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,903,358 (GRCm38) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,907,612 (GRCm38) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,907,612 (GRCm38) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,904,056 (GRCm38) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,925,354 (GRCm38) intron probably benign
R4701:Cfap65 UTSW 1 74,918,908 (GRCm38) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,928,361 (GRCm38) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,927,632 (GRCm38) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,917,295 (GRCm38) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,925,557 (GRCm38) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,919,261 (GRCm38) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,907,613 (GRCm38) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,903,124 (GRCm38) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,906,336 (GRCm38) nonsense probably null
R5074:Cfap65 UTSW 1 74,922,978 (GRCm38) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,906,441 (GRCm38) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,926,516 (GRCm38) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,924,902 (GRCm38) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,903,175 (GRCm38) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,925,100 (GRCm38) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,907,518 (GRCm38) intron probably benign
R5669:Cfap65 UTSW 1 74,924,968 (GRCm38) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,923,031 (GRCm38) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,920,405 (GRCm38) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,903,139 (GRCm38) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,927,709 (GRCm38) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,904,685 (GRCm38) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,917,286 (GRCm38) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,932,021 (GRCm38) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,925,115 (GRCm38) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,931,899 (GRCm38) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,926,633 (GRCm38) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,926,604 (GRCm38) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,921,583 (GRCm38) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,920,426 (GRCm38) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,926,610 (GRCm38) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,902,434 (GRCm38) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,933,144 (GRCm38) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,928,368 (GRCm38) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,926,625 (GRCm38) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,933,162 (GRCm38) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,910,743 (GRCm38) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,917,169 (GRCm38) nonsense probably null
R8431:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,928,044 (GRCm38) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,905,937 (GRCm38) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,903,223 (GRCm38) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,902,188 (GRCm38) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,920,393 (GRCm38) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,904,688 (GRCm38) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,919,351 (GRCm38) splice site probably benign
R9187:Cfap65 UTSW 1 74,917,358 (GRCm38) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,920,408 (GRCm38) missense probably benign
R9212:Cfap65 UTSW 1 74,920,408 (GRCm38) missense probably benign
R9273:Cfap65 UTSW 1 74,921,610 (GRCm38) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,905,051 (GRCm38) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,906,309 (GRCm38) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,907,378 (GRCm38) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,919,342 (GRCm38) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,904,681 (GRCm38) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,905,647 (GRCm38) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,910,747 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATTCTGAGGGCAGCTCAGTATC -3'
(R):5'- CTCGGTTCATGCCAGCTTCTACAG -3'

Sequencing Primer
(F):5'- ttttttttttAGAGTTTTGCGTGGTG -3'
(R):5'- TGCCAGCTTCTACAGCATAG -3'
Posted On 2013-11-18