Incidental Mutation 'R1079:Olfr1151'
ID85772
Institutional Source Beutler Lab
Gene Symbol Olfr1151
Ensembl Gene ENSMUSG00000047039
Gene Nameolfactory receptor 1151
SynonymsMOR177-9, GA_x6K02T2Q125-49358694-49359620
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1079 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87855862-87859923 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87857355 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000151107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061081] [ENSMUST00000217376]
Predicted Effect probably damaging
Transcript: ENSMUST00000061081
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055394
Gene: ENSMUSG00000047039
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.6e-45 PFAM
Pfam:7tm_1 41 290 1.7e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217376
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.434 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Arsa G A 15: 89,474,225 probably benign Het
Baz1a T A 12: 54,895,000 I1474L possibly damaging Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Cryba2 A T 1: 74,890,558 V140E probably damaging Het
Dennd4b G A 3: 90,271,178 R516K probably benign Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Ikzf2 T C 1: 69,539,105 D341G possibly damaging Het
Kif3a G C 11: 53,570,581 V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 D246E probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
N6amt1 T C 16: 87,356,198 V52A probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Nudt12 G A 17: 59,011,037 probably benign Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Pan2 A G 10: 128,318,238 T1050A probably damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in Olfr1151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01755:Olfr1151 APN 2 87857510 missense possibly damaging 0.60
IGL02314:Olfr1151 APN 2 87858056 missense probably damaging 1.00
R0127:Olfr1151 UTSW 2 87857483 missense probably benign
R0233:Olfr1151 UTSW 2 87857752 missense probably benign 0.19
R0233:Olfr1151 UTSW 2 87857752 missense probably benign 0.19
R0398:Olfr1151 UTSW 2 87858057 missense probably damaging 1.00
R1598:Olfr1151 UTSW 2 87857751 missense probably benign 0.01
R1965:Olfr1151 UTSW 2 87857415 missense probably benign 0.44
R3409:Olfr1151 UTSW 2 87857661 nonsense probably null
R4824:Olfr1151 UTSW 2 87857277 missense probably benign 0.24
R4962:Olfr1151 UTSW 2 87857288 missense probably benign 0.02
R4986:Olfr1151 UTSW 2 87857514 missense probably damaging 0.97
R5324:Olfr1151 UTSW 2 87857696 missense probably damaging 1.00
R5934:Olfr1151 UTSW 2 87857241 missense probably benign
R6335:Olfr1151 UTSW 2 87857467 nonsense probably null
R6389:Olfr1151 UTSW 2 87858023 missense probably damaging 1.00
R6958:Olfr1151 UTSW 2 87857951 missense probably damaging 1.00
R7329:Olfr1151 UTSW 2 87857241 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAAACTGCTCCTCTGTGGATG -3'
(R):5'- CTCAGCAGAACGGATCTTCAGGAC -3'

Sequencing Primer
(F):5'- CCTGTCAAAAAAGTGGCCCT -3'
(R):5'- GTTGTTGCCACCAGGTAAAC -3'
Posted On2013-11-18