Incidental Mutation 'R1079:Pan2'
ID85789
Institutional Source Beutler Lab
Gene Symbol Pan2
Ensembl Gene ENSMUSG00000005682
Gene NamePAN2 poly(A) specific ribonuclease subunit
SynonymsUsp52, 1200014O24Rik
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1079 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128303335-128321358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128318238 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1050 (T1050A)
Ref Sequence ENSEMBL: ENSMUSP00000151216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005825] [ENSMUST00000026446] [ENSMUST00000218315] [ENSMUST00000219037] [ENSMUST00000219721] [ENSMUST00000219836]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005825
AA Change: T1059A

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000005825
Gene: ENSMUSG00000005682
AA Change: T1059A

DomainStartEndE-ValueType
low complexity region 67 79 N/A INTRINSIC
SCOP:d1tbga_ 151 357 4e-11 SMART
Blast:WD40 225 271 4e-11 BLAST
low complexity region 412 425 N/A INTRINSIC
Pfam:UCH 515 920 2.6e-15 PFAM
Pfam:UCH_1 516 897 9.7e-70 PFAM
low complexity region 938 949 N/A INTRINSIC
EXOIII 972 1155 1.68e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026446
SMART Domains Protein: ENSMUSP00000026446
Gene: ENSMUSG00000025381

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:DUF3456 27 171 1e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218315
AA Change: T1050A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218496
Predicted Effect probably benign
Transcript: ENSMUST00000219037
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219255
Predicted Effect probably damaging
Transcript: ENSMUST00000219721
AA Change: T1032A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000219836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220391
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deadenylase that functions as the catalytic subunit of the polyadenylate binding protein dependent poly(A) nuclease complex. The encoded protein is a magnesium dependent 3' to 5' exoribonuclease that is involved in the degradation of cytoplasmic mRNAs. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Arsa G A 15: 89,474,225 probably benign Het
Baz1a T A 12: 54,895,000 I1474L possibly damaging Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Cryba2 A T 1: 74,890,558 V140E probably damaging Het
Dennd4b G A 3: 90,271,178 R516K probably benign Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Ikzf2 T C 1: 69,539,105 D341G possibly damaging Het
Kif3a G C 11: 53,570,581 V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 D246E probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
N6amt1 T C 16: 87,356,198 V52A probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Nudt12 G A 17: 59,011,037 probably benign Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr1151 A G 2: 87,857,355 Y60C probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in Pan2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Pan2 APN 10 128312926 nonsense probably null
IGL02183:Pan2 APN 10 128309075 missense possibly damaging 0.74
IGL02219:Pan2 APN 10 128320352 missense probably benign 0.04
IGL02514:Pan2 APN 10 128310741 missense possibly damaging 0.94
IGL02552:Pan2 APN 10 128319027 missense probably damaging 1.00
IGL02623:Pan2 APN 10 128312899 missense probably benign
IGL02860:Pan2 APN 10 128310735 nonsense probably null
IGL03104:Pan2 APN 10 128315663 splice site probably benign
IGL03372:Pan2 APN 10 128315127 missense probably benign 0.09
R0541:Pan2 UTSW 10 128308222 missense possibly damaging 0.87
R0585:Pan2 UTSW 10 128310515 critical splice donor site probably null
R1650:Pan2 UTSW 10 128317899 missense probably damaging 1.00
R1847:Pan2 UTSW 10 128304378 missense possibly damaging 0.71
R1867:Pan2 UTSW 10 128313181 missense probably damaging 1.00
R1903:Pan2 UTSW 10 128308368 missense probably damaging 0.98
R1975:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R1976:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R1977:Pan2 UTSW 10 128320413 missense probably damaging 0.99
R2136:Pan2 UTSW 10 128313637 missense possibly damaging 0.95
R2162:Pan2 UTSW 10 128304222 missense possibly damaging 0.90
R2512:Pan2 UTSW 10 128304457 missense probably damaging 1.00
R2566:Pan2 UTSW 10 128313897 missense probably damaging 1.00
R2900:Pan2 UTSW 10 128308342 missense probably benign
R3957:Pan2 UTSW 10 128315177 missense probably damaging 0.99
R4571:Pan2 UTSW 10 128308643 missense probably benign 0.05
R5112:Pan2 UTSW 10 128315595 nonsense probably null
R5120:Pan2 UTSW 10 128314995 critical splice donor site probably null
R5183:Pan2 UTSW 10 128317969 missense probably damaging 1.00
R5325:Pan2 UTSW 10 128317634 missense possibly damaging 0.59
R5539:Pan2 UTSW 10 128308133 missense probably benign 0.16
R5642:Pan2 UTSW 10 128308100 missense probably benign 0.00
R5740:Pan2 UTSW 10 128308164 missense probably damaging 1.00
R5822:Pan2 UTSW 10 128320380 missense probably damaging 1.00
R6766:Pan2 UTSW 10 128314512 missense possibly damaging 0.79
R6902:Pan2 UTSW 10 128315637 missense probably benign 0.33
R6946:Pan2 UTSW 10 128315637 missense probably benign 0.33
R7206:Pan2 UTSW 10 128314545 nonsense probably null
R7490:Pan2 UTSW 10 128308440 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCACGCAGGAGCAGGTGAGA -3'
(R):5'- CAAGTTGGGTTGGAAGAAGGCTGTAT -3'

Sequencing Primer
(F):5'- GCATTGAAGTCAACCCTGTG -3'
(R):5'- ggaggaggcaggcgaac -3'
Posted On2013-11-18