Mutagenetix > Incidental Mutation

Incidental Mutation 'R1079:Sall2'

85798

Institutional Source

Beutler Lab

Gene Symbol

Sall2

Ensembl Gene

ENSMUSG00000049532

Gene Name

spalt like transcription factor 2

Synonyms

Msal-2

MMRRC Submission

039165-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1079 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

52311172-52328762 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 52313203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 843 (H843L)

Ref Sequence

ENSEMBL: ENSMUSP00000154331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058326] [ENSMUST00000135523]

AlphaFold

Q9QX96

Predicted Effect

probably benign
Transcript: ENSMUST00000058326
AA Change: H845L

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000056401
Gene: ENSMUSG00000049532
AA Change: H845L

Domain	Start	End	E-Value	Type
low complexity region	71	81	N/A	INTRINSIC
low complexity region	97	110	N/A	INTRINSIC
low complexity region	128	139	N/A	INTRINSIC
low complexity region	151	170	N/A	INTRINSIC
ZnF_C2H2	372	394	2.57e-3	SMART
ZnF_C2H2	400	422	1.28e-3	SMART
low complexity region	476	501	N/A	INTRINSIC
low complexity region	602	627	N/A	INTRINSIC
ZnF_C2H2	629	651	1.2e1	SMART
ZnF_C2H2	657	679	1.69e-3	SMART
ZnF_C2H2	689	711	6.88e-4	SMART
low complexity region	719	730	N/A	INTRINSIC
low complexity region	747	779	N/A	INTRINSIC
low complexity region	799	819	N/A	INTRINSIC
low complexity region	829	848	N/A	INTRINSIC
ZnF_C2H2	908	930	2.09e-3	SMART
ZnF_C2H2	937	960	1.01e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135523
AA Change: H843L

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

98% (46/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple zinc finger domains. The encoded protein functions in optical fissure closure during development of the eye in the embryo. Mutations in this gene are associated with ocular coloboma. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in no apparent abnormal phenotypes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2200002J24Rik	T	C	7: 30,699,784	M1T	probably null	Het
Adam25	T	C	8: 40,755,476	V593A	possibly damaging	Het
Agrn	C	T	4: 156,177,225	C536Y	probably damaging	Het
Amigo3	T	C	9: 108,053,852	M158T	probably benign	Het
Arsa	G	A	15: 89,474,225		probably benign	Het
Baz1a	T	A	12: 54,895,000	I1474L	possibly damaging	Het
Cfap65	G	A	1: 74,902,447	A1776V	probably damaging	Het
Cfap65	A	G	1: 74,905,713	V1455A	probably damaging	Het
Cnot6	G	T	11: 49,685,103	D176E	probably benign	Het
Crot	A	T	5: 8,993,504		probably null	Het
Cryba2	A	T	1: 74,890,558	V140E	probably damaging	Het
Dennd4b	G	A	3: 90,271,178	R516K	probably benign	Het
Dst	C	A	1: 34,186,863	T1697N	possibly damaging	Het
Eftud2	G	T	11: 102,840,044	Y837*	probably null	Het
Evpl	G	T	11: 116,230,068	T447K	possibly damaging	Het
Fam183b	A	G	11: 58,801,794	Y36H	probably benign	Het
Fndc3a	A	T	14: 72,589,807	M146K	possibly damaging	Het
Folh1	G	T	7: 86,771,881	T80K	probably damaging	Het
Gm4922	T	A	10: 18,784,338	Y212F	probably damaging	Het
Gtf2i	T	G	5: 134,242,894		probably benign	Het
Hipk3	A	G	2: 104,471,698	F50L	probably benign	Het
Ifit1bl2	T	A	19: 34,619,485	T244S	probably benign	Het
Ikzf2	T	C	1: 69,539,105	D341G	possibly damaging	Het
Kif3a	G	C	11: 53,570,581	V17L	possibly damaging	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Lzts2	T	A	19: 45,023,544	N137K	probably damaging	Het
Mphosph8	T	A	14: 56,674,259	D246E	probably damaging	Het
Myh14	T	C	7: 44,630,002	E918G	probably damaging	Het
N6amt1	T	C	16: 87,356,198	V52A	probably damaging	Het
Npr2	A	C	4: 43,643,654	T561P	probably damaging	Het
Nudt12	G	A	17: 59,011,037		probably benign	Het
Olfr1054	T	A	2: 86,332,841	R172W	probably damaging	Het
Olfr1151	A	G	2: 87,857,355	Y60C	probably damaging	Het
Olfr287	A	C	15: 98,208,342	V14G	probably damaging	Het
Olfr430	A	T	1: 174,069,466	H56L	possibly damaging	Het
Pan2	A	G	10: 128,318,238	T1050A	probably damaging	Het
Rad17	G	T	13: 100,633,899	D213E	probably benign	Het
Sdk2	C	T	11: 113,838,646		silent	Het
Sema3e	A	T	5: 14,225,655	N258I	probably benign	Het
Siglec1	G	A	2: 131,079,377	R625*	probably null	Het
Slc15a3	T	C	19: 10,855,980	S454P	probably benign	Het
Sp110	G	A	1: 85,589,104		probably benign	Het
Spatc1l	T	C	10: 76,563,907	S88P	probably damaging	Het
Ssh3	A	C	19: 4,266,549	L143R	probably damaging	Het
Ttn	C	T	2: 76,756,996		probably benign	Het
Vps35	A	G	8: 85,279,054	L306S	probably damaging	Het
Zfp729a	T	C	13: 67,619,675	I812V	possibly damaging	Het

Other mutations in Sall2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01587:Sall2	APN	14	52314571	missense	probably damaging	1.00
IGL02152:Sall2	APN	14	52315514	missense	probably damaging	1.00
IGL02318:Sall2	APN	14	52315565	missense	probably damaging	1.00
IGL02933:Sall2	APN	14	52313027	missense	probably benign	0.00
IGL03165:Sall2	APN	14	52314168	missense	probably damaging	1.00
R1295:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1674:Sall2	UTSW	14	52313836	missense	probably damaging	1.00
R1840:Sall2	UTSW	14	52313725	missense	probably damaging	1.00
R1989:Sall2	UTSW	14	52314439	missense	probably damaging	1.00
R2339:Sall2	UTSW	14	52313356	missense	probably damaging	1.00
R3407:Sall2	UTSW	14	52328104	missense	probably benign	0.03
R3870:Sall2	UTSW	14	52313994	missense	probably damaging	1.00
R3895:Sall2	UTSW	14	52314047	missense	probably damaging	0.99
R4059:Sall2	UTSW	14	52314571	missense	probably damaging	1.00
R4272:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4273:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4275:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4289:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4503:Sall2	UTSW	14	52313459	missense	probably benign
R4592:Sall2	UTSW	14	52313803	missense	probably damaging	1.00
R4611:Sall2	UTSW	14	52313753	missense	probably damaging	1.00
R4615:Sall2	UTSW	14	52312750	missense	probably benign	0.20
R4640:Sall2	UTSW	14	52315159	missense	probably damaging	0.99
R4693:Sall2	UTSW	14	52314478	missense	probably damaging	1.00
R4921:Sall2	UTSW	14	52315393	missense	possibly damaging	0.93
R5007:Sall2	UTSW	14	52314493	missense	probably damaging	1.00
R5015:Sall2	UTSW	14	52315655	missense	possibly damaging	0.92
R5079:Sall2	UTSW	14	52314754	missense	probably damaging	1.00
R5419:Sall2	UTSW	14	52313129	missense	probably damaging	1.00
R5849:Sall2	UTSW	14	52314247	missense	probably benign	0.13
R6229:Sall2	UTSW	14	52313191	missense	probably benign
R6397:Sall2	UTSW	14	52315153	missense	probably damaging	1.00
R6422:Sall2	UTSW	14	52312724	makesense	probably null
R6456:Sall2	UTSW	14	52313593	missense	probably damaging	1.00
R6456:Sall2	UTSW	14	52313594	nonsense	probably null
R6786:Sall2	UTSW	14	52314621	missense	probably damaging	1.00
R7293:Sall2	UTSW	14	52314411	nonsense	probably null
R7496:Sall2	UTSW	14	52315561	missense	possibly damaging	0.63
R7792:Sall2	UTSW	14	52316064	missense	probably damaging	1.00
R8324:Sall2	UTSW	14	52312886	missense	probably benign	0.30
R9017:Sall2	UTSW	14	52313262	missense	possibly damaging	0.51
R9149:Sall2	UTSW	14	52313216	missense	possibly damaging	0.95
R9362:Sall2	UTSW	14	52313144	nonsense	probably null
R9571:Sall2	UTSW	14	52314373	missense	probably damaging	1.00
R9574:Sall2	UTSW	14	52314160	missense	probably damaging	1.00
R9641:Sall2	UTSW	14	52313425	missense	probably damaging	1.00
R9648:Sall2	UTSW	14	52313767	missense	probably damaging	1.00
R9694:Sall2	UTSW	14	52314667	missense	possibly damaging	0.63

Predicted Primers

PCR Primer
(F):5'- GGCTTCCGGTAAGTTCAGCTCTTC -3'
(R):5'- ACATTTCGTGGGTCACAAGACCAG -3'

Sequencing Primer
(F):5'- GTTCAGCTCTTCCACCAAAGG -3'
(R):5'- aggaagaggaagaggatgagg -3'

Posted On

2013-11-18