Incidental Mutation 'R1079:Arsa'
ID85801
Institutional Source Beutler Lab
Gene Symbol Arsa
Ensembl Gene ENSMUSG00000022620
Gene Namearylsulfatase A
SynonymsAs2, As-2, ASA, AS-A
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R1079 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89472476-89477425 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 89474225 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000165199]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023292
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136218
Predicted Effect probably benign
Transcript: ENSMUST00000165199
SMART Domains Protein: ENSMUSP00000127646
Gene: ENSMUSG00000022620

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Sulfatase 20 345 4.2e-79 PFAM
Pfam:Sulfatase_C 367 501 1.9e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168052
Predicted Effect probably benign
Transcript: ENSMUST00000168270
SMART Domains Protein: ENSMUSP00000130574
Gene: ENSMUSG00000022620

DomainStartEndE-ValueType
Pfam:Sulfatase 1 37 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168835
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene hydrolyzes cerebroside sulfate to cerebroside and sulfate. Defects in this gene lead to metachromatic leucodystrophy (MLD), a progressive demyelination disease which results in a variety of neurological symptoms and ultimately death. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mice exhibit impaired balance and spatial learning ability. Sulfatide accumulates in the white matter of the brain and a reduced myelin sheath thickness in the corpus callosum and optic nerves is seen. A low frequency of head tremor develops after 2 years of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Baz1a T A 12: 54,895,000 I1474L possibly damaging Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Cryba2 A T 1: 74,890,558 V140E probably damaging Het
Dennd4b G A 3: 90,271,178 R516K probably benign Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Ikzf2 T C 1: 69,539,105 D341G possibly damaging Het
Kif3a G C 11: 53,570,581 V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 D246E probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
N6amt1 T C 16: 87,356,198 V52A probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Nudt12 G A 17: 59,011,037 probably benign Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr1151 A G 2: 87,857,355 Y60C probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Pan2 A G 10: 128,318,238 T1050A probably damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in Arsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02079:Arsa APN 15 89473351 missense probably benign 0.04
IGL02381:Arsa APN 15 89475537 nonsense probably null
IGL02416:Arsa APN 15 89474788 missense probably damaging 1.00
IGL02997:Arsa APN 15 89474038 missense probably damaging 0.99
R0066:Arsa UTSW 15 89474336 missense possibly damaging 0.88
R0066:Arsa UTSW 15 89474336 missense possibly damaging 0.88
R0630:Arsa UTSW 15 89474004 splice site probably benign
R1052:Arsa UTSW 15 89475177 missense probably damaging 1.00
R1807:Arsa UTSW 15 89475322 missense possibly damaging 0.54
R1943:Arsa UTSW 15 89473539 missense probably damaging 1.00
R2231:Arsa UTSW 15 89475722 start codon destroyed probably null
R5099:Arsa UTSW 15 89475339 missense probably damaging 1.00
R5461:Arsa UTSW 15 89473275 missense probably benign
R6259:Arsa UTSW 15 89475521 missense probably damaging 1.00
R7159:Arsa UTSW 15 89474718 splice site probably null
R7188:Arsa UTSW 15 89475627 nonsense probably null
R7735:Arsa UTSW 15 89474949 nonsense probably null
R7943:Arsa UTSW 15 89474089 missense probably damaging 1.00
R8127:Arsa UTSW 15 89474864 missense probably damaging 1.00
R8287:Arsa UTSW 15 89473390 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TACTCAGGGGCCACTCATCAAAGG -3'
(R):5'- TCGAGAGGTGCTAGGCACGTTATG -3'

Sequencing Primer
(F):5'- GAGACATGAGGCATGTACTCTCC -3'
(R):5'- TATGGTGATCCATAACCAGCAGTG -3'
Posted On2013-11-18