Incidental Mutation 'R1079:N6amt1'
ID85803
Institutional Source Beutler Lab
Gene Symbol N6amt1
Ensembl Gene ENSMUSG00000044442
Gene NameN-6 adenine-specific DNA methyltransferase 1 (putative)
SynonymsHemk2, Pred28, 5830445C04Rik
MMRRC Submission 039165-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1079 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location87354185-87368742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87356198 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 52 (V52A)
Ref Sequence ENSEMBL: ENSMUSP00000113229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054442] [ENSMUST00000118115] [ENSMUST00000118310] [ENSMUST00000120284]
Predicted Effect probably damaging
Transcript: ENSMUST00000054442
AA Change: V52A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061835
Gene: ENSMUSG00000044442
AA Change: V52A

DomainStartEndE-ValueType
Pfam:MTS 26 202 4.2e-12 PFAM
Pfam:Methyltransf_26 45 175 6.7e-15 PFAM
Pfam:Methyltransf_31 45 213 5.2e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000118115
AA Change: V52A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113217
Gene: ENSMUSG00000044442
AA Change: V52A

DomainStartEndE-ValueType
Pfam:MTS 21 179 2e-14 PFAM
Pfam:Methyltransf_26 46 175 1.6e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118310
AA Change: V52A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113229
Gene: ENSMUSG00000044442
AA Change: V52A

DomainStartEndE-ValueType
Pfam:MTS 20 137 1.7e-12 PFAM
Pfam:PrmA 27 123 6.9e-7 PFAM
Pfam:Methyltransf_26 45 137 2.7e-13 PFAM
Pfam:Methyltransf_25 49 138 6.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120284
AA Change: V52A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112510
Gene: ENSMUSG00000044442
AA Change: V52A

DomainStartEndE-ValueType
Pfam:MTS 20 150 3.4e-12 PFAM
Pfam:PrmA 27 123 1.4e-6 PFAM
Pfam:Methyltransf_26 46 148 1.4e-12 PFAM
Pfam:Methyltransf_25 49 147 1.7e-7 PFAM
Meta Mutation Damage Score 0.6034 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an N(6)-adenine-specific DNA methyltransferase. The encoded enzyme may be involved in the methylation of release factor I during translation termination. This enzyme is also involved in converting the arsenic metabolite monomethylarsonous acid to the less toxic dimethylarsonic acid. Alternative splicing pf this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 11. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele fail to form a primitive streak and die between E7.5 and E9.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2200002J24Rik T C 7: 30,699,784 M1T probably null Het
Adam25 T C 8: 40,755,476 V593A possibly damaging Het
Agrn C T 4: 156,177,225 C536Y probably damaging Het
Amigo3 T C 9: 108,053,852 M158T probably benign Het
Arsa G A 15: 89,474,225 probably benign Het
Baz1a T A 12: 54,895,000 I1474L possibly damaging Het
Cfap65 G A 1: 74,902,447 A1776V probably damaging Het
Cfap65 A G 1: 74,905,713 V1455A probably damaging Het
Cnot6 G T 11: 49,685,103 D176E probably benign Het
Crot A T 5: 8,993,504 probably null Het
Cryba2 A T 1: 74,890,558 V140E probably damaging Het
Dennd4b G A 3: 90,271,178 R516K probably benign Het
Dst C A 1: 34,186,863 T1697N possibly damaging Het
Eftud2 G T 11: 102,840,044 Y837* probably null Het
Evpl G T 11: 116,230,068 T447K possibly damaging Het
Fam183b A G 11: 58,801,794 Y36H probably benign Het
Fndc3a A T 14: 72,589,807 M146K possibly damaging Het
Folh1 G T 7: 86,771,881 T80K probably damaging Het
Gm4922 T A 10: 18,784,338 Y212F probably damaging Het
Gtf2i T G 5: 134,242,894 probably benign Het
Hipk3 A G 2: 104,471,698 F50L probably benign Het
Ifit1bl2 T A 19: 34,619,485 T244S probably benign Het
Ikzf2 T C 1: 69,539,105 D341G possibly damaging Het
Kif3a G C 11: 53,570,581 V17L possibly damaging Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Lzts2 T A 19: 45,023,544 N137K probably damaging Het
Mphosph8 T A 14: 56,674,259 D246E probably damaging Het
Myh14 T C 7: 44,630,002 E918G probably damaging Het
Npr2 A C 4: 43,643,654 T561P probably damaging Het
Nudt12 G A 17: 59,011,037 probably benign Het
Olfr1054 T A 2: 86,332,841 R172W probably damaging Het
Olfr1151 A G 2: 87,857,355 Y60C probably damaging Het
Olfr287 A C 15: 98,208,342 V14G probably damaging Het
Olfr430 A T 1: 174,069,466 H56L possibly damaging Het
Pan2 A G 10: 128,318,238 T1050A probably damaging Het
Rad17 G T 13: 100,633,899 D213E probably benign Het
Sall2 T A 14: 52,313,203 H843L probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sema3e A T 5: 14,225,655 N258I probably benign Het
Siglec1 G A 2: 131,079,377 R625* probably null Het
Slc15a3 T C 19: 10,855,980 S454P probably benign Het
Sp110 G A 1: 85,589,104 probably benign Het
Spatc1l T C 10: 76,563,907 S88P probably damaging Het
Ssh3 A C 19: 4,266,549 L143R probably damaging Het
Ttn C T 2: 76,756,996 probably benign Het
Vps35 A G 8: 85,279,054 L306S probably damaging Het
Zfp729a T C 13: 67,619,675 I812V possibly damaging Het
Other mutations in N6amt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3028:N6amt1 UTSW 16 87362648 missense probably benign 0.00
R4692:N6amt1 UTSW 16 87356966 missense possibly damaging 0.65
R5324:N6amt1 UTSW 16 87354353 missense probably damaging 1.00
R5686:N6amt1 UTSW 16 87354335 missense probably damaging 1.00
R7001:N6amt1 UTSW 16 87354292 missense probably benign 0.30
R7223:N6amt1 UTSW 16 87362660 makesense probably null
R7419:N6amt1 UTSW 16 87367566 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGCCCAACACAGTACTCTCGTAGG -3'
(R):5'- GAGCTGCAAGAAACACATTTGTCCC -3'

Sequencing Primer
(F):5'- TACTCTCGTAGGGAGAGAGGTC -3'
(R):5'- CCAGCATAAGCTGTGACTTG -3'
Posted On2013-11-18