Incidental Mutation 'R1080:Nck2'
ID 85811
Institutional Source Beutler Lab
Gene Symbol Nck2
Ensembl Gene ENSMUSG00000066877
Gene Name non-catalytic region of tyrosine kinase adaptor protein 2
Synonyms 4833426I10Rik, Grb4, NCKbeta
MMRRC Submission 039166-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1080 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 43444579-43570515 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43533581 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 5 (V5A)
Ref Sequence ENSEMBL: ENSMUSP00000083611 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086421] [ENSMUST00000187435] [ENSMUST00000202540]
AlphaFold O55033
Predicted Effect probably benign
Transcript: ENSMUST00000086421
AA Change: V5A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000083611
Gene: ENSMUSG00000066877
AA Change: V5A

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect unknown
Transcript: ENSMUST00000114744
AA Change: V4A
SMART Domains Protein: ENSMUSP00000110392
Gene: ENSMUSG00000066877
AA Change: V4A

DomainStartEndE-ValueType
SH3 5 60 7.06e-17 SMART
SH3 114 169 8.56e-16 SMART
SH3 198 256 2.09e-19 SMART
SH2 283 365 2.86e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187435
AA Change: V5A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000202540
AA Change: V5A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000144224
Gene: ENSMUSG00000066877
AA Change: V5A

DomainStartEndE-ValueType
SH3 5 60 4.3e-19 SMART
PDB:2CUB|A 106 142 4e-13 PDB
Blast:SH3 114 142 3e-11 BLAST
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruption of this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
4932438A13Rik A G 3: 36,988,255 T2797A probably damaging Het
Agbl3 A T 6: 34,828,235 N679I probably benign Het
Akp3 T A 1: 87,127,001 F353I probably damaging Het
Calu A G 6: 29,366,920 T44A possibly damaging Het
Cd180 G A 13: 102,706,220 W591* probably null Het
Cnbd2 A G 2: 156,339,273 N209S probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fam136b-ps T C 15: 31,276,593 probably benign Het
Fbln5 A T 12: 101,750,872 M419K possibly damaging Het
Galr1 A C 18: 82,405,507 I215S probably damaging Het
Kcnma1 G C 14: 23,494,607 Q436E probably damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Klhdc8b T C 9: 108,449,638 N175S probably benign Het
Lrrk2 T C 15: 91,673,689 V76A probably benign Het
Mnat1 T C 12: 73,272,518 F305S probably damaging Het
Nkd1 T A 8: 88,592,019 M428K probably benign Het
Olfr1507 A T 14: 52,490,585 Y43* probably null Het
Pcdh7 T C 5: 57,719,426 C108R probably damaging Het
Rtf2 G T 2: 172,468,746 W299L probably damaging Het
Smtn C A 11: 3,517,693 R942L probably damaging Het
Svil C T 18: 5,058,147 P265S possibly damaging Het
Tdrd3 T C 14: 87,506,398 L588P probably benign Het
Tecpr1 A G 5: 144,216,929 Y169H probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmprss2 G A 16: 97,591,498 S83L probably benign Het
Vmn2r112 T C 17: 22,618,999 S814P probably damaging Het
Zcchc11 A G 4: 108,479,499 E140G possibly damaging Het
Zfp386 T A 12: 116,059,806 C381* probably null Het
Zfp809 T G 9: 22,235,109 D31E probably damaging Het
Zfy2 T A Y: 2,121,645 T83S probably benign Het
Zswim6 A G 13: 107,787,651 noncoding transcript Het
Other mutations in Nck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
wake UTSW 1 43554260 missense probably benign
R0420:Nck2 UTSW 1 43554118 missense probably damaging 1.00
R0503:Nck2 UTSW 1 43533568 start codon destroyed probably null 0.96
R0538:Nck2 UTSW 1 43569144 splice site probably benign
R2509:Nck2 UTSW 1 43554233 missense probably damaging 1.00
R4029:Nck2 UTSW 1 43554091 missense probably benign
R4923:Nck2 UTSW 1 43461071 intron probably benign
R5425:Nck2 UTSW 1 43554392 missense probably benign 0.05
R6175:Nck2 UTSW 1 43533569 start codon destroyed probably null 0.96
R6683:Nck2 UTSW 1 43569178 missense probably benign
R6859:Nck2 UTSW 1 43554351 missense probably benign 0.24
R7514:Nck2 UTSW 1 43569221 missense probably benign 0.00
R8021:Nck2 UTSW 1 43554260 missense probably benign
R8278:Nck2 UTSW 1 43554580 missense probably damaging 1.00
R9004:Nck2 UTSW 1 43554350 missense
R9063:Nck2 UTSW 1 43554343 missense possibly damaging 0.91
Z1088:Nck2 UTSW 1 43554383 missense possibly damaging 0.55
Z1177:Nck2 UTSW 1 43554356 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACGGGTAGGTCATTCTAAGGGCAAG -3'
(R):5'- CAACAGTGCTATCCCGAGTGTTCC -3'

Sequencing Primer
(F):5'- AGTGCTTCAAGGGGCTGG -3'
(R):5'- GTATGGACACTCACCTAGTGTG -3'
Posted On 2013-11-18