Incidental Mutation 'R1080:Cnbd2'
ID85814
Institutional Source Beutler Lab
Gene Symbol Cnbd2
Ensembl Gene ENSMUSG00000038085
Gene Namecyclic nucleotide binding domain containing 2
Synonyms
MMRRC Submission 039166-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R1080 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location156312299-156375638 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156339273 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 209 (N209S)
Ref Sequence ENSEMBL: ENSMUSP00000073598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037096] [ENSMUST00000073942] [ENSMUST00000109580]
Predicted Effect probably benign
Transcript: ENSMUST00000037096
AA Change: N326S

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041268
Gene: ENSMUSG00000038085
AA Change: N326S

DomainStartEndE-ValueType
low complexity region 45 68 N/A INTRINSIC
cNMP 206 332 1.78e-7 SMART
Blast:cNMP 376 443 4e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000073942
AA Change: N209S

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000073598
Gene: ENSMUSG00000038085
AA Change: N209S

DomainStartEndE-ValueType
cNMP 89 215 1.78e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109580
AA Change: N197S

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000105208
Gene: ENSMUSG00000038085
AA Change: N197S

DomainStartEndE-ValueType
cNMP 77 203 1.78e-7 SMART
Blast:cNMP 247 314 3e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131801
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154227
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced male fertility associated with impaired spermiogenesis and development of flagellum bending. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
4932438A13Rik A G 3: 36,988,255 T2797A probably damaging Het
Agbl3 A T 6: 34,828,235 N679I probably benign Het
Akp3 T A 1: 87,127,001 F353I probably damaging Het
Calu A G 6: 29,366,920 T44A possibly damaging Het
Cd180 G A 13: 102,706,220 W591* probably null Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fam136b-ps T C 15: 31,276,593 probably benign Het
Fbln5 A T 12: 101,750,872 M419K possibly damaging Het
Galr1 A C 18: 82,405,507 I215S probably damaging Het
Kcnma1 G C 14: 23,494,607 Q436E probably damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Klhdc8b T C 9: 108,449,638 N175S probably benign Het
Lrrk2 T C 15: 91,673,689 V76A probably benign Het
Mnat1 T C 12: 73,272,518 F305S probably damaging Het
Nck2 T C 1: 43,533,581 V5A probably benign Het
Nkd1 T A 8: 88,592,019 M428K probably benign Het
Olfr1507 A T 14: 52,490,585 Y43* probably null Het
Pcdh7 T C 5: 57,719,426 C108R probably damaging Het
Rtf2 G T 2: 172,468,746 W299L probably damaging Het
Smtn C A 11: 3,517,693 R942L probably damaging Het
Svil C T 18: 5,058,147 P265S possibly damaging Het
Tdrd3 T C 14: 87,506,398 L588P probably benign Het
Tecpr1 A G 5: 144,216,929 Y169H probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmprss2 G A 16: 97,591,498 S83L probably benign Het
Vmn2r112 T C 17: 22,618,999 S814P probably damaging Het
Zcchc11 A G 4: 108,479,499 E140G possibly damaging Het
Zfp386 T A 12: 116,059,806 C381* probably null Het
Zfp809 T G 9: 22,235,109 D31E probably damaging Het
Zfy2 T A Y: 2,121,645 T83S probably benign Het
Zswim6 A G 13: 107,787,651 noncoding transcript Het
Other mutations in Cnbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Cnbd2 APN 2 156312614 unclassified probably benign
IGL01472:Cnbd2 APN 2 156375348 missense probably damaging 1.00
IGL01738:Cnbd2 APN 2 156375617 utr 3 prime probably benign
IGL01825:Cnbd2 APN 2 156338709 missense probably damaging 1.00
IGL03001:Cnbd2 APN 2 156333634 critical splice donor site probably null
IGL03057:Cnbd2 APN 2 156367672 missense possibly damaging 0.80
R1006:Cnbd2 UTSW 2 156328408 missense possibly damaging 0.86
R1428:Cnbd2 UTSW 2 156339284 critical splice donor site probably null
R1592:Cnbd2 UTSW 2 156335402 missense probably benign 0.30
R1601:Cnbd2 UTSW 2 156333631 missense probably damaging 0.98
R1637:Cnbd2 UTSW 2 156373724 missense probably damaging 1.00
R2259:Cnbd2 UTSW 2 156335272 missense probably damaging 1.00
R2352:Cnbd2 UTSW 2 156335355 missense probably damaging 1.00
R4106:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R4109:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R4479:Cnbd2 UTSW 2 156333653 intron probably benign
R4857:Cnbd2 UTSW 2 156367565 missense probably benign 0.01
R4893:Cnbd2 UTSW 2 156365184 missense probably damaging 0.97
R4899:Cnbd2 UTSW 2 156339221 missense probably benign 0.00
R5070:Cnbd2 UTSW 2 156335398 missense probably damaging 1.00
R5446:Cnbd2 UTSW 2 156367661 missense possibly damaging 0.95
R5784:Cnbd2 UTSW 2 156338657 missense probably damaging 1.00
R6197:Cnbd2 UTSW 2 156375574 missense possibly damaging 0.86
R7009:Cnbd2 UTSW 2 156320034 missense probably benign 0.00
R7221:Cnbd2 UTSW 2 156373661 missense probably benign 0.01
R7577:Cnbd2 UTSW 2 156328376 missense possibly damaging 0.93
X0002:Cnbd2 UTSW 2 156338697 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- CCAGGAAATGGGCCTTCTAAGCAC -3'
(R):5'- ATGCACTCAGCCTCTGTCAGCTAC -3'

Sequencing Primer
(F):5'- TTCTAAGCACCACAGTAAGGAGTG -3'
(R):5'- ggtttggtttggtttggtttttc -3'
Posted On2013-11-18