Incidental Mutation 'R1080:Rtf2'
ID85815
Institutional Source Beutler Lab
Gene Symbol Rtf2
Ensembl Gene ENSMUSG00000027502
Gene Namereplication termination factor 2
Synonyms
MMRRC Submission 039166-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.936) question?
Stock #R1080 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location172440556-172469908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 172468746 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 299 (W299L)
Ref Sequence ENSEMBL: ENSMUSP00000029005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029005] [ENSMUST00000029007]
Predicted Effect probably damaging
Transcript: ENSMUST00000029005
AA Change: W299L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029005
Gene: ENSMUSG00000027502
AA Change: W299L

DomainStartEndE-ValueType
Pfam:Rtf2 1 290 1.5e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029007
SMART Domains Protein: ENSMUSP00000029007
Gene: ENSMUSG00000027505

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:FAM209 21 168 9.1e-78 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140048
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
4932438A13Rik A G 3: 36,988,255 T2797A probably damaging Het
Agbl3 A T 6: 34,828,235 N679I probably benign Het
Akp3 T A 1: 87,127,001 F353I probably damaging Het
Calu A G 6: 29,366,920 T44A possibly damaging Het
Cd180 G A 13: 102,706,220 W591* probably null Het
Cnbd2 A G 2: 156,339,273 N209S probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fam136b-ps T C 15: 31,276,593 probably benign Het
Fbln5 A T 12: 101,750,872 M419K possibly damaging Het
Galr1 A C 18: 82,405,507 I215S probably damaging Het
Kcnma1 G C 14: 23,494,607 Q436E probably damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Klhdc8b T C 9: 108,449,638 N175S probably benign Het
Lrrk2 T C 15: 91,673,689 V76A probably benign Het
Mnat1 T C 12: 73,272,518 F305S probably damaging Het
Nck2 T C 1: 43,533,581 V5A probably benign Het
Nkd1 T A 8: 88,592,019 M428K probably benign Het
Olfr1507 A T 14: 52,490,585 Y43* probably null Het
Pcdh7 T C 5: 57,719,426 C108R probably damaging Het
Smtn C A 11: 3,517,693 R942L probably damaging Het
Svil C T 18: 5,058,147 P265S possibly damaging Het
Tdrd3 T C 14: 87,506,398 L588P probably benign Het
Tecpr1 A G 5: 144,216,929 Y169H probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmprss2 G A 16: 97,591,498 S83L probably benign Het
Vmn2r112 T C 17: 22,618,999 S814P probably damaging Het
Zcchc11 A G 4: 108,479,499 E140G possibly damaging Het
Zfp386 T A 12: 116,059,806 C381* probably null Het
Zfp809 T G 9: 22,235,109 D31E probably damaging Het
Zfy2 T A Y: 2,121,645 T83S probably benign Het
Zswim6 A G 13: 107,787,651 noncoding transcript Het
Other mutations in Rtf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Rtf2 APN 2 172466292 missense unknown
IGL02268:Rtf2 APN 2 172468719 missense probably damaging 1.00
IGL02340:Rtf2 APN 2 172468591 unclassified probably benign
R0040:Rtf2 UTSW 2 172444696 missense probably damaging 1.00
R0621:Rtf2 UTSW 2 172466296 missense possibly damaging 0.60
R1580:Rtf2 UTSW 2 172445365 missense probably damaging 1.00
R2105:Rtf2 UTSW 2 172445365 missense probably damaging 1.00
R5461:Rtf2 UTSW 2 172445332 missense probably damaging 1.00
R7839:Rtf2 UTSW 2 172466333 critical splice donor site probably null
R7922:Rtf2 UTSW 2 172466333 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAACTAATGGGAGTGCGTCTG -3'
(R):5'- ACCCTGTGAGGAGCAAGGTCTAAG -3'

Sequencing Primer
(F):5'- TCTGGGAAAGTTGGCAAGC -3'
(R):5'- CTAAGACTGTTGGAAGTCTGTCCC -3'
Posted On2013-11-18