Incidental Mutation 'R1080:Cd180'
ID85837
Institutional Source Beutler Lab
Gene Symbol Cd180
Ensembl Gene ENSMUSG00000021624
Gene NameCD180 antigen
SynonymsLy78, RP105
MMRRC Submission 039166-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1080 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location102693558-102739629 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 102706220 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 591 (W591*)
Ref Sequence ENSEMBL: ENSMUSP00000022124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]
PDB Structure
Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000022124
AA Change: W591*
SMART Domains Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: W591*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRR 76 99 1.07e0 SMART
LRR 193 221 1.76e2 SMART
LRR 297 320 1.66e1 SMART
Pfam:LRR_8 321 382 4.2e-13 PFAM
LRR 395 418 3e1 SMART
LRR 444 467 3.09e1 SMART
LRR 495 518 4.97e0 SMART
LRR 519 542 2.4e1 SMART
low complexity region 555 567 N/A INTRINSIC
LRRCT 577 626 5.11e-8 SMART
transmembrane domain 628 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167144
SMART Domains Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170878
SMART Domains Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 3e-38 PDB
SCOP:d1m0za_ 35 84 4e-4 SMART
Blast:LRR 51 75 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171267
SMART Domains Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
PDB:3T6Q|B 21 86 2e-38 PDB
SCOP:d1m0za_ 35 84 9e-4 SMART
Blast:LRR 51 75 7e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172138
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
4932438A13Rik A G 3: 36,988,255 T2797A probably damaging Het
Agbl3 A T 6: 34,828,235 N679I probably benign Het
Akp3 T A 1: 87,127,001 F353I probably damaging Het
Calu A G 6: 29,366,920 T44A possibly damaging Het
Cnbd2 A G 2: 156,339,273 N209S probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fam136b-ps T C 15: 31,276,593 probably benign Het
Fbln5 A T 12: 101,750,872 M419K possibly damaging Het
Galr1 A C 18: 82,405,507 I215S probably damaging Het
Kcnma1 G C 14: 23,494,607 Q436E probably damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Klhdc8b T C 9: 108,449,638 N175S probably benign Het
Lrrk2 T C 15: 91,673,689 V76A probably benign Het
Mnat1 T C 12: 73,272,518 F305S probably damaging Het
Nck2 T C 1: 43,533,581 V5A probably benign Het
Nkd1 T A 8: 88,592,019 M428K probably benign Het
Olfr1507 A T 14: 52,490,585 Y43* probably null Het
Pcdh7 T C 5: 57,719,426 C108R probably damaging Het
Rtf2 G T 2: 172,468,746 W299L probably damaging Het
Smtn C A 11: 3,517,693 R942L probably damaging Het
Svil C T 18: 5,058,147 P265S possibly damaging Het
Tdrd3 T C 14: 87,506,398 L588P probably benign Het
Tecpr1 A G 5: 144,216,929 Y169H probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmprss2 G A 16: 97,591,498 S83L probably benign Het
Vmn2r112 T C 17: 22,618,999 S814P probably damaging Het
Zcchc11 A G 4: 108,479,499 E140G possibly damaging Het
Zfp386 T A 12: 116,059,806 C381* probably null Het
Zfp809 T G 9: 22,235,109 D31E probably damaging Het
Zfy2 T A Y: 2,121,645 T83S probably benign Het
Zswim6 A G 13: 107,787,651 noncoding transcript Het
Other mutations in Cd180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Cd180 APN 13 102705409 missense probably benign
IGL00949:Cd180 APN 13 102693760 missense possibly damaging 0.89
IGL01864:Cd180 APN 13 102706033 missense possibly damaging 0.93
IGL01901:Cd180 APN 13 102706428 missense probably benign 0.04
IGL01934:Cd180 APN 13 102702858 missense probably damaging 1.00
IGL01998:Cd180 APN 13 102705214 missense probably damaging 0.99
IGL02336:Cd180 APN 13 102705313 missense probably damaging 0.98
IGL03031:Cd180 APN 13 102705027 missense probably benign 0.00
IGL03139:Cd180 APN 13 102706416 missense probably damaging 1.00
Volte_face UTSW 13 102704923 missense probably damaging 0.99
H8562:Cd180 UTSW 13 102705418 missense probably benign 0.02
R0004:Cd180 UTSW 13 102702708 missense probably benign 0.00
R0393:Cd180 UTSW 13 102705900 missense probably damaging 0.99
R0565:Cd180 UTSW 13 102702874 intron probably benign
R1223:Cd180 UTSW 13 102706222 missense possibly damaging 0.49
R1669:Cd180 UTSW 13 102705490 missense probably damaging 1.00
R1772:Cd180 UTSW 13 102706242 missense probably benign 0.11
R1784:Cd180 UTSW 13 102705859 missense probably damaging 1.00
R1865:Cd180 UTSW 13 102706009 missense probably benign
R2252:Cd180 UTSW 13 102706398 nonsense probably null
R2385:Cd180 UTSW 13 102705183 missense probably benign 0.00
R4653:Cd180 UTSW 13 102704908 missense probably damaging 1.00
R4695:Cd180 UTSW 13 102705760 missense probably benign 0.01
R4790:Cd180 UTSW 13 102702822 missense probably damaging 0.98
R4934:Cd180 UTSW 13 102739164 critical splice acceptor site probably null
R5052:Cd180 UTSW 13 102704895 missense probably benign
R5154:Cd180 UTSW 13 102705774 missense probably damaging 1.00
R5469:Cd180 UTSW 13 102704834 missense probably benign 0.37
R5493:Cd180 UTSW 13 102706141 missense probably benign 0.07
R5615:Cd180 UTSW 13 102706203 missense probably benign 0.34
R5905:Cd180 UTSW 13 102706033 missense possibly damaging 0.93
R6282:Cd180 UTSW 13 102693757 missense possibly damaging 0.90
R6433:Cd180 UTSW 13 102705633 missense probably benign 0.00
R6456:Cd180 UTSW 13 102702836 missense probably damaging 1.00
R6784:Cd180 UTSW 13 102702705 missense probably damaging 0.97
R6815:Cd180 UTSW 13 102705429 missense probably damaging 1.00
R6838:Cd180 UTSW 13 102702731 missense probably benign 0.38
R6941:Cd180 UTSW 13 102706191 missense probably benign 0.23
R7048:Cd180 UTSW 13 102704923 missense probably damaging 0.99
R7338:Cd180 UTSW 13 102706428 missense probably benign 0.04
R7466:Cd180 UTSW 13 102704995 missense probably damaging 1.00
R7647:Cd180 UTSW 13 102705943 missense probably damaging 1.00
R8179:Cd180 UTSW 13 102705633 missense probably benign 0.00
R8252:Cd180 UTSW 13 102705996 missense probably benign 0.00
R8300:Cd180 UTSW 13 102704793 missense probably benign 0.01
R8460:Cd180 UTSW 13 102702846 missense probably damaging 1.00
Z1176:Cd180 UTSW 13 102705766 missense probably damaging 1.00
Z1177:Cd180 UTSW 13 102706032 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTCACAACAGGCTGACATCCAGTAG -3'
(R):5'- TGTTCAGAAAAGCTCAGTGAACCCC -3'

Sequencing Primer
(F):5'- ATCCAGTAGCATTGAGGCTC -3'
(R):5'- GGTCACTCAAGGATGACAGTTTC -3'
Posted On2013-11-18