Incidental Mutation 'R1080:Fam136b-ps'
ID85842
Institutional Source Beutler Lab
Gene Symbol Fam136b-ps
Ensembl Gene ENSMUSG00000055416
Gene Namefamily with sequence similarity 136, member B, pseudogene
SynonymsGm6624
MMRRC Submission 039166-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1080 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location31276491-31276907 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 31276593 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044524] [ENSMUST00000068987] [ENSMUST00000185618] [ENSMUST00000186109] [ENSMUST00000186425] [ENSMUST00000186547]
Predicted Effect probably benign
Transcript: ENSMUST00000044524
SMART Domains Protein: ENSMUSP00000047186
Gene: ENSMUSG00000039168

DomainStartEndE-ValueType
Pfam:DAP 12 102 3.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068987
SMART Domains Protein: ENSMUSP00000125904
Gene: ENSMUSG00000055416

DomainStartEndE-ValueType
Pfam:DUF842 5 132 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185618
SMART Domains Protein: ENSMUSP00000140568
Gene: ENSMUSG00000039168

DomainStartEndE-ValueType
Pfam:DAP 3 62 4.5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186109
Predicted Effect probably benign
Transcript: ENSMUST00000186425
SMART Domains Protein: ENSMUSP00000140007
Gene: ENSMUSG00000039168

DomainStartEndE-ValueType
Pfam:DAP 1 79 6.5e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186547
SMART Domains Protein: ENSMUSP00000140481
Gene: ENSMUSG00000039168

DomainStartEndE-ValueType
Pfam:DAP 1 79 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik A G 7: 27,565,684 N87S probably benign Het
4932438A13Rik A G 3: 36,988,255 T2797A probably damaging Het
Agbl3 A T 6: 34,828,235 N679I probably benign Het
Akp3 T A 1: 87,127,001 F353I probably damaging Het
Calu A G 6: 29,366,920 T44A possibly damaging Het
Cd180 G A 13: 102,706,220 W591* probably null Het
Cnbd2 A G 2: 156,339,273 N209S probably benign Het
Fam120a G T 13: 48,885,743 A979E possibly damaging Het
Fbln5 A T 12: 101,750,872 M419K possibly damaging Het
Galr1 A C 18: 82,405,507 I215S probably damaging Het
Kcnma1 G C 14: 23,494,607 Q436E probably damaging Het
Khsrp GTCATT GT 17: 57,024,410 probably null Het
Klhdc8b T C 9: 108,449,638 N175S probably benign Het
Lrrk2 T C 15: 91,673,689 V76A probably benign Het
Mnat1 T C 12: 73,272,518 F305S probably damaging Het
Nck2 T C 1: 43,533,581 V5A probably benign Het
Nkd1 T A 8: 88,592,019 M428K probably benign Het
Olfr1507 A T 14: 52,490,585 Y43* probably null Het
Pcdh7 T C 5: 57,719,426 C108R probably damaging Het
Rtf2 G T 2: 172,468,746 W299L probably damaging Het
Smtn C A 11: 3,517,693 R942L probably damaging Het
Svil C T 18: 5,058,147 P265S possibly damaging Het
Tdrd3 T C 14: 87,506,398 L588P probably benign Het
Tecpr1 A G 5: 144,216,929 Y169H probably damaging Het
Tktl2 G A 8: 66,512,347 V186M probably damaging Het
Tmprss2 G A 16: 97,591,498 S83L probably benign Het
Vmn2r112 T C 17: 22,618,999 S814P probably damaging Het
Zcchc11 A G 4: 108,479,499 E140G possibly damaging Het
Zfp386 T A 12: 116,059,806 C381* probably null Het
Zfp809 T G 9: 22,235,109 D31E probably damaging Het
Zfy2 T A Y: 2,121,645 T83S probably benign Het
Zswim6 A G 13: 107,787,651 noncoding transcript Het
Other mutations in Fam136b-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Fam136b-ps APN 15 31276864 unclassified probably benign
R5033:Fam136b-ps UTSW 15 31276897 unclassified probably benign
R5070:Fam136b-ps UTSW 15 31276716 unclassified probably benign
R5110:Fam136b-ps UTSW 15 31276710 unclassified probably benign
R6629:Fam136b-ps UTSW 15 31276816 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGTCACTGTCAACACACGGGTGC -3'
(R):5'- TCTTAAATAGCCTGCCCGCAGTCC -3'

Sequencing Primer
(F):5'- CACCATGGTGAAAAGTGTGGA -3'
(R):5'- ATGTGGTCATCCACACACTTGG -3'
Posted On2013-11-18