Incidental Mutation 'R1082:Sf3b1'
ID 85852
Institutional Source Beutler Lab
Gene Symbol Sf3b1
Ensembl Gene ENSMUSG00000025982
Gene Name splicing factor 3b, subunit 1
Synonyms Prp10, SAP155, SF3b155, 2810001M05Rik, Targ4
MMRRC Submission 039168-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1082 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 55024328-55066640 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to G at 55058554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glutamine at position 12 (E12Q)
Ref Sequence ENSEMBL: ENSMUSP00000139469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027127] [ENSMUST00000191303]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027127
AA Change: E12Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000027127
Gene: ENSMUSG00000025982
AA Change: E12Q

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
internal_repeat_1 185 276 1.77e-12 PROSPERO
Pfam:SF3b1 329 452 1.2e-51 PFAM
SCOP:d1qbkb_ 489 1289 5e-62 SMART
Blast:ARM 593 637 6e-13 BLAST
Blast:ARM 1005 1044 7e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188419
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189051
Predicted Effect possibly damaging
Transcript: ENSMUST00000191303
AA Change: E12Q

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139469
Gene: ENSMUSG00000025982
AA Change: E12Q

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
low complexity region 65 75 N/A INTRINSIC
Meta Mutation Damage Score 0.1366 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos die around the 16- to 32-cell stage. Heterozygous mice exhibit various skeletal transformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik G A 3: 137,879,332 (GRCm39) R239C possibly damaging Het
Aass T A 6: 23,093,907 (GRCm39) D138V probably damaging Het
Adam30 T C 3: 98,069,606 (GRCm39) S480P probably benign Het
Bdkrb2 T A 12: 105,558,851 (GRCm39) M364K probably benign Het
Bnc2 T C 4: 84,464,572 (GRCm39) D67G probably damaging Het
Cfap52 A G 11: 67,815,998 (GRCm39) I595T probably damaging Het
Clspn A T 4: 126,471,572 (GRCm39) N909Y possibly damaging Het
Ddx46 T C 13: 55,802,909 (GRCm39) V477A possibly damaging Het
Dna2 C T 10: 62,784,966 (GRCm39) R28W probably benign Het
Dnah3 A G 7: 119,677,668 (GRCm39) S419P probably damaging Het
Fat3 A G 9: 15,917,911 (GRCm39) F1504S probably damaging Het
Guf1 G T 5: 69,724,555 (GRCm39) V416L possibly damaging Het
Hsd11b2 A G 8: 106,249,783 (GRCm39) D298G probably damaging Het
Mipol1 A T 12: 57,372,402 (GRCm39) I154F probably damaging Het
Myo18b A G 5: 112,908,280 (GRCm39) S1998P probably damaging Het
Myo6 C T 9: 80,195,303 (GRCm39) T891M probably damaging Het
Nbeal1 T A 1: 60,351,385 (GRCm39) I2461K probably damaging Het
Notch4 T C 17: 34,806,364 (GRCm39) F1767S probably damaging Het
Or7e178 A T 9: 20,225,765 (GRCm39) H150Q possibly damaging Het
Pi4ka A T 16: 17,207,216 (GRCm39) S30T probably damaging Het
Ppp1r26 A G 2: 28,342,146 (GRCm39) D592G probably damaging Het
Ptp4a2 T C 4: 129,741,580 (GRCm39) F157L probably benign Het
Shank3 T C 15: 89,433,574 (GRCm39) S1365P probably damaging Het
Slc27a6 T A 18: 58,689,632 (GRCm39) Y33N probably damaging Het
Slco1a7 C T 6: 141,657,859 (GRCm39) G560S probably damaging Het
Speg T A 1: 75,391,782 (GRCm39) S1572T possibly damaging Het
Taf6 G A 5: 138,180,949 (GRCm39) R211C possibly damaging Het
Tyrobp T C 7: 30,114,033 (GRCm39) S65P probably damaging Het
Other mutations in Sf3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Sf3b1 APN 1 55,026,645 (GRCm39) missense probably damaging 1.00
IGL00815:Sf3b1 APN 1 55,036,090 (GRCm39) splice site probably benign
IGL01380:Sf3b1 APN 1 55,027,108 (GRCm39) missense probably damaging 1.00
IGL01390:Sf3b1 APN 1 55,026,588 (GRCm39) missense probably benign 0.17
IGL02974:Sf3b1 APN 1 55,046,866 (GRCm39) missense probably benign 0.00
IGL03159:Sf3b1 APN 1 55,051,372 (GRCm39) missense probably benign
Colt UTSW 1 55,036,315 (GRCm39) missense probably benign 0.45
Glock UTSW 1 55,040,205 (GRCm39) missense probably damaging 0.96
Handgun UTSW 1 55,046,666 (GRCm39) missense probably damaging 1.00
Kalashnikov UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
Magazine UTSW 1 55,051,341 (GRCm39) nonsense probably null
Revolver UTSW 1 55,058,548 (GRCm39) nonsense probably null
R0053:Sf3b1 UTSW 1 55,039,532 (GRCm39) nonsense probably null
R0053:Sf3b1 UTSW 1 55,039,532 (GRCm39) nonsense probably null
R0190:Sf3b1 UTSW 1 55,029,465 (GRCm39) missense probably damaging 0.99
R0277:Sf3b1 UTSW 1 55,058,416 (GRCm39) missense probably damaging 0.99
R0323:Sf3b1 UTSW 1 55,058,416 (GRCm39) missense probably damaging 0.99
R0369:Sf3b1 UTSW 1 55,037,267 (GRCm39) missense probably benign 0.10
R0396:Sf3b1 UTSW 1 55,058,430 (GRCm39) missense probably damaging 1.00
R0718:Sf3b1 UTSW 1 55,058,544 (GRCm39) missense probably damaging 0.99
R0991:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1083:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1084:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1196:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1376:Sf3b1 UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
R1376:Sf3b1 UTSW 1 55,058,424 (GRCm39) missense probably damaging 0.99
R1381:Sf3b1 UTSW 1 55,042,313 (GRCm39) missense probably damaging 0.99
R1436:Sf3b1 UTSW 1 55,040,580 (GRCm39) missense possibly damaging 0.72
R1559:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1560:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1561:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1567:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1568:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1588:Sf3b1 UTSW 1 55,036,336 (GRCm39) missense probably benign 0.05
R1625:Sf3b1 UTSW 1 55,058,536 (GRCm39) missense probably damaging 1.00
R1694:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense possibly damaging 0.89
R1735:Sf3b1 UTSW 1 55,039,811 (GRCm39) missense probably damaging 1.00
R1900:Sf3b1 UTSW 1 55,037,347 (GRCm39) missense possibly damaging 0.75
R2186:Sf3b1 UTSW 1 55,046,792 (GRCm39) missense probably benign
R2429:Sf3b1 UTSW 1 55,055,960 (GRCm39) missense possibly damaging 0.71
R2473:Sf3b1 UTSW 1 55,038,785 (GRCm39) critical splice donor site probably null
R3772:Sf3b1 UTSW 1 55,039,150 (GRCm39) intron probably benign
R3911:Sf3b1 UTSW 1 55,058,548 (GRCm39) nonsense probably null
R3970:Sf3b1 UTSW 1 55,051,341 (GRCm39) nonsense probably null
R4706:Sf3b1 UTSW 1 55,029,666 (GRCm39) missense probably damaging 1.00
R4707:Sf3b1 UTSW 1 55,029,666 (GRCm39) missense probably damaging 1.00
R4964:Sf3b1 UTSW 1 55,038,871 (GRCm39) missense probably benign
R5053:Sf3b1 UTSW 1 55,036,336 (GRCm39) missense probably benign 0.05
R5358:Sf3b1 UTSW 1 55,042,469 (GRCm39) missense probably benign 0.09
R5379:Sf3b1 UTSW 1 55,042,309 (GRCm39) missense possibly damaging 0.94
R5628:Sf3b1 UTSW 1 55,037,334 (GRCm39) missense probably benign 0.27
R5636:Sf3b1 UTSW 1 55,036,352 (GRCm39) missense probably damaging 1.00
R6013:Sf3b1 UTSW 1 55,039,457 (GRCm39) missense probably damaging 0.98
R6149:Sf3b1 UTSW 1 55,046,666 (GRCm39) missense probably damaging 1.00
R6217:Sf3b1 UTSW 1 55,046,677 (GRCm39) missense probably damaging 1.00
R6426:Sf3b1 UTSW 1 55,038,814 (GRCm39) missense probably benign 0.01
R6531:Sf3b1 UTSW 1 55,058,554 (GRCm39) missense probably damaging 0.99
R6945:Sf3b1 UTSW 1 55,036,315 (GRCm39) missense probably benign 0.45
R7001:Sf3b1 UTSW 1 55,053,640 (GRCm39) critical splice donor site probably null
R7001:Sf3b1 UTSW 1 55,040,205 (GRCm39) missense probably damaging 0.96
R7302:Sf3b1 UTSW 1 55,055,949 (GRCm39) missense probably benign 0.00
R7644:Sf3b1 UTSW 1 55,036,302 (GRCm39) nonsense probably null
R7664:Sf3b1 UTSW 1 55,026,626 (GRCm39) missense probably damaging 1.00
R7735:Sf3b1 UTSW 1 55,042,508 (GRCm39) missense probably benign 0.29
R7809:Sf3b1 UTSW 1 55,034,614 (GRCm39) missense possibly damaging 0.60
R8516:Sf3b1 UTSW 1 55,051,262 (GRCm39) missense probably null 0.01
R8871:Sf3b1 UTSW 1 55,029,508 (GRCm39) missense probably damaging 1.00
R8947:Sf3b1 UTSW 1 55,039,444 (GRCm39) missense probably damaging 1.00
R9216:Sf3b1 UTSW 1 55,051,376 (GRCm39) missense probably benign 0.00
Z1177:Sf3b1 UTSW 1 55,042,561 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCCAGTGAGGACCCTAGTATTAAGC -3'
(R):5'- TCCTTTCACCTGATGAGGTCAGGAG -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- GAGGTCAGGAGATACATGTGTAGAT -3'
Posted On 2013-11-18