Incidental Mutation 'R1082:Hsd11b2'
ID85869
Institutional Source Beutler Lab
Gene Symbol Hsd11b2
Ensembl Gene ENSMUSG00000031891
Gene Namehydroxysteroid 11-beta dehydrogenase 2
Synonyms11HSD2, 11(beta)-HSD2
MMRRC Submission 039168-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1082 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105518755-105523988 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105523151 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 298 (D298G)
Ref Sequence ENSEMBL: ENSMUSP00000034363 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013304] [ENSMUST00000034363]
Predicted Effect probably benign
Transcript: ENSMUST00000013304
SMART Domains Protein: ENSMUSP00000013304
Gene: ENSMUSG00000013160

DomainStartEndE-ValueType
Pfam:vATP-synt_AC39 16 347 2.4e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000034363
AA Change: D298G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034363
Gene: ENSMUSG00000031891
AA Change: D298G

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
low complexity region 34 44 N/A INTRINSIC
low complexity region 51 65 N/A INTRINSIC
Pfam:adh_short 83 278 9.2e-47 PFAM
Pfam:adh_short_C2 89 294 2e-11 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least two isozymes of the corticosteroid 11-beta-dehydrogenase, a microsomal enzyme complex responsible for the interconversion of cortisol and cortisone. The type I isozyme has both 11-beta-dehydrogenase (cortisol to cortisone) and 11-oxoreductase (cortisone to cortisol) activities. The type II isozyme, encoded by this gene, has only 11-beta-dehydrogenase activity. In aldosterone-selective epithelial tissues such as the kidney, the type II isozyme catalyzes the glucocorticoid cortisol to the inactive metabolite cortisone, thus preventing illicit activation of the mineralocorticoid receptor. In tissues that do not express the mineralocorticoid receptor, such as the placenta and testis, it protects cells from the growth-inhibiting and/or pro-apoptotic effects of cortisol, particularly during embryonic development. Mutations in this gene cause the syndrome of apparent mineralocorticoid excess and hypertension. [provided by RefSeq, Feb 2010]
PHENOTYPE: About half of all mice homozygous for disruptions in this gene die within 48 hours of birth. Survivors are subject to sudden unexplained deaths when between 2 and 4 months of age. They are hypertensive with dilute urine and are hypokalemic and hypochloremic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik G A 3: 138,173,571 R239C possibly damaging Het
Aass T A 6: 23,093,908 D138V probably damaging Het
Adam30 T C 3: 98,162,290 S480P probably benign Het
Bdkrb2 T A 12: 105,592,592 M364K probably benign Het
Bnc2 T C 4: 84,546,335 D67G probably damaging Het
Cfap52 A G 11: 67,925,172 I595T probably damaging Het
Clspn A T 4: 126,577,779 N909Y possibly damaging Het
Ddx46 T C 13: 55,655,096 V477A possibly damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah3 A G 7: 120,078,445 S419P probably damaging Het
Fat3 A G 9: 16,006,615 F1504S probably damaging Het
Gm5724 C T 6: 141,712,133 G560S probably damaging Het
Guf1 G T 5: 69,567,212 V416L possibly damaging Het
Mipol1 A T 12: 57,325,616 I154F probably damaging Het
Myo18b A G 5: 112,760,414 S1998P probably damaging Het
Myo6 C T 9: 80,288,021 T891M probably damaging Het
Nbeal1 T A 1: 60,312,226 I2461K probably damaging Het
Notch4 T C 17: 34,587,390 F1767S probably damaging Het
Olfr18 A T 9: 20,314,469 H150Q possibly damaging Het
Pi4ka A T 16: 17,389,352 S30T probably damaging Het
Ppp1r26 A G 2: 28,452,134 D592G probably damaging Het
Ptp4a2 T C 4: 129,847,787 F157L probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Shank3 T C 15: 89,549,371 S1365P probably damaging Het
Slc27a6 T A 18: 58,556,560 Y33N probably damaging Het
Speg T A 1: 75,415,138 S1572T possibly damaging Het
Taf6 G A 5: 138,182,687 R211C possibly damaging Het
Tyrobp T C 7: 30,414,608 S65P probably damaging Het
Other mutations in Hsd11b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Hsd11b2 APN 8 105523127 missense probably benign 0.06
IGL01620:Hsd11b2 APN 8 105522897 missense probably benign 0.04
IGL02257:Hsd11b2 APN 8 105523222 missense probably benign 0.04
IGL02655:Hsd11b2 APN 8 105522328 missense probably benign 0.00
gilberto UTSW 8 105523067 missense possibly damaging 0.96
R0254:Hsd11b2 UTSW 8 105523067 missense possibly damaging 0.96
R2050:Hsd11b2 UTSW 8 105523360 missense probably benign 0.27
R4135:Hsd11b2 UTSW 8 105523166 missense probably benign
R5294:Hsd11b2 UTSW 8 105523297 missense probably benign 0.01
R5598:Hsd11b2 UTSW 8 105522511 missense probably benign
R5780:Hsd11b2 UTSW 8 105522155 missense probably damaging 1.00
R6058:Hsd11b2 UTSW 8 105523334 missense possibly damaging 0.59
R6867:Hsd11b2 UTSW 8 105522317 missense probably benign 0.00
R7535:Hsd11b2 UTSW 8 105519123 missense probably damaging 0.99
R7786:Hsd11b2 UTSW 8 105518874 missense probably damaging 0.99
R8006:Hsd11b2 UTSW 8 105519103 missense possibly damaging 0.95
R8110:Hsd11b2 UTSW 8 105522634 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAAGCCTGGCTGCTTCAAGAC -3'
(R):5'- GTGGTGGATGAAATACATGAGCCCC -3'

Sequencing Primer
(F):5'- GGCTGCTTCAAGACAGGTG -3'
(R):5'- CATGAGCCCCAGGCCAC -3'
Posted On2013-11-18