Incidental Mutation 'R1082:Cfap52'
ID85876
Institutional Source Beutler Lab
Gene Symbol Cfap52
Ensembl Gene ENSMUSG00000020904
Gene Namecilia and flagella associated protein 52
Synonyms4933417B11Rik, Wdr16, 1700019F09Rik
MMRRC Submission 039168-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.814) question?
Stock #R1082 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location67924806-67965651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67925172 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 595 (I595T)
Ref Sequence ENSEMBL: ENSMUSP00000021287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021287] [ENSMUST00000021288] [ENSMUST00000108677]
Predicted Effect probably damaging
Transcript: ENSMUST00000021287
AA Change: I595T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021287
Gene: ENSMUSG00000020904
AA Change: I595T

DomainStartEndE-ValueType
WD40 53 97 3.71e-1 SMART
WD40 100 141 3.45e-3 SMART
WD40 149 186 1.03e1 SMART
low complexity region 262 273 N/A INTRINSIC
WD40 280 318 9.86e1 SMART
WD40 321 360 6.6e1 SMART
WD40 363 402 8.56e0 SMART
WD40 405 445 2.27e-3 SMART
WD40 450 489 3.14e-6 SMART
WD40 492 530 9.21e0 SMART
WD40 533 573 6.19e-5 SMART
WD40 576 615 2.15e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021288
SMART Domains Protein: ENSMUSP00000021288
Gene: ENSMUSG00000020905

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 707 2.8e-61 PFAM
Pfam:UCH_1 101 297 1.3e-6 PFAM
Pfam:UCH_1 503 689 5.2e-13 PFAM
low complexity region 717 731 N/A INTRINSIC
low complexity region 958 972 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000068548
Predicted Effect probably benign
Transcript: ENSMUST00000108677
SMART Domains Protein: ENSMUSP00000104317
Gene: ENSMUSG00000020905

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
low complexity region 59 87 N/A INTRINSIC
Pfam:UCH 100 702 3.5e-54 PFAM
Pfam:UCH_1 101 298 2.7e-7 PFAM
Pfam:UCH_1 503 684 1.2e-9 PFAM
low complexity region 712 726 N/A INTRINSIC
low complexity region 953 967 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152120
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WD repeat-containing proteins, such as WDR16, play crucial roles in a wide range of physiologic functions, including signal transduction, RNA processing, remodeling the cytoskeleton, regulation of vesicular traffic, and cell division (Silva et al., 2005 [PubMed 15967112]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik G A 3: 138,173,571 R239C possibly damaging Het
Aass T A 6: 23,093,908 D138V probably damaging Het
Adam30 T C 3: 98,162,290 S480P probably benign Het
Bdkrb2 T A 12: 105,592,592 M364K probably benign Het
Bnc2 T C 4: 84,546,335 D67G probably damaging Het
Clspn A T 4: 126,577,779 N909Y possibly damaging Het
Ddx46 T C 13: 55,655,096 V477A possibly damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah3 A G 7: 120,078,445 S419P probably damaging Het
Fat3 A G 9: 16,006,615 F1504S probably damaging Het
Gm5724 C T 6: 141,712,133 G560S probably damaging Het
Guf1 G T 5: 69,567,212 V416L possibly damaging Het
Hsd11b2 A G 8: 105,523,151 D298G probably damaging Het
Mipol1 A T 12: 57,325,616 I154F probably damaging Het
Myo18b A G 5: 112,760,414 S1998P probably damaging Het
Myo6 C T 9: 80,288,021 T891M probably damaging Het
Nbeal1 T A 1: 60,312,226 I2461K probably damaging Het
Notch4 T C 17: 34,587,390 F1767S probably damaging Het
Olfr18 A T 9: 20,314,469 H150Q possibly damaging Het
Pi4ka A T 16: 17,389,352 S30T probably damaging Het
Ppp1r26 A G 2: 28,452,134 D592G probably damaging Het
Ptp4a2 T C 4: 129,847,787 F157L probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Shank3 T C 15: 89,549,371 S1365P probably damaging Het
Slc27a6 T A 18: 58,556,560 Y33N probably damaging Het
Speg T A 1: 75,415,138 S1572T possibly damaging Het
Taf6 G A 5: 138,182,687 R211C possibly damaging Het
Tyrobp T C 7: 30,414,608 S65P probably damaging Het
Other mutations in Cfap52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:Cfap52 APN 11 67953580 missense possibly damaging 0.67
IGL02034:Cfap52 APN 11 67946292 splice site probably null
IGL02530:Cfap52 APN 11 67954181 splice site probably benign
IGL02558:Cfap52 APN 11 67954138 missense probably benign 0.31
IGL02873:Cfap52 APN 11 67931782 missense probably damaging 1.00
IGL02887:Cfap52 APN 11 67953515 missense probably damaging 1.00
IGL02956:Cfap52 APN 11 67954075 missense probably benign
IGL03068:Cfap52 APN 11 67935856 missense probably benign 0.11
IGL03216:Cfap52 APN 11 67954106 missense possibly damaging 0.81
IGL03287:Cfap52 APN 11 67935976 unclassified probably benign
IGL03370:Cfap52 APN 11 67939055 missense probably damaging 0.98
chewbacca UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0103:Cfap52 UTSW 11 67925125 missense possibly damaging 0.95
R0244:Cfap52 UTSW 11 67926382 missense possibly damaging 0.90
R0306:Cfap52 UTSW 11 67954070 missense probably benign
R0364:Cfap52 UTSW 11 67953610 missense possibly damaging 0.80
R0440:Cfap52 UTSW 11 67954088 missense probably benign
R0565:Cfap52 UTSW 11 67949599 missense probably benign 0.00
R1068:Cfap52 UTSW 11 67939004 missense probably benign 0.10
R1509:Cfap52 UTSW 11 67938993 missense probably benign 0.00
R1894:Cfap52 UTSW 11 67953619 critical splice acceptor site probably null
R2994:Cfap52 UTSW 11 67939791 missense probably benign
R3954:Cfap52 UTSW 11 67930865 missense probably benign
R4611:Cfap52 UTSW 11 67926421 missense probably damaging 0.99
R4922:Cfap52 UTSW 11 67931722 critical splice donor site probably null
R5624:Cfap52 UTSW 11 67927358 missense possibly damaging 0.92
R5762:Cfap52 UTSW 11 67954121 missense possibly damaging 0.71
R5970:Cfap52 UTSW 11 67930744 missense probably damaging 1.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6037:Cfap52 UTSW 11 67946300 missense probably benign 0.00
R6260:Cfap52 UTSW 11 67938954 missense possibly damaging 0.85
R7401:Cfap52 UTSW 11 67949633 missense probably benign 0.02
R7580:Cfap52 UTSW 11 67946320 missense probably damaging 1.00
R7831:Cfap52 UTSW 11 67935956 missense possibly damaging 0.89
R7966:Cfap52 UTSW 11 67953745 splice site probably null
R8303:Cfap52 UTSW 11 67939795 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTTATGCAAACTTGGCCCTGGAC -3'
(R):5'- ACCCATCAATGTGCCTCCATGC -3'

Sequencing Primer
(F):5'- CCATCACGAAGCAAATGGGT -3'
(R):5'- TCCTTCAAGCTGGCACATGG -3'
Posted On2013-11-18