Incidental Mutation 'R1082:Bdkrb2'
ID85879
Institutional Source Beutler Lab
Gene Symbol Bdkrb2
Ensembl Gene ENSMUSG00000021070
Gene Namebradykinin receptor, beta 2
Synonymskinin B2, B2R, B(2), B2, BK2R
MMRRC Submission 039168-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R1082 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location105563226-105595237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 105592592 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 364 (M364K)
Ref Sequence ENSEMBL: ENSMUSP00000001652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001652]
Predicted Effect probably benign
Transcript: ENSMUST00000001652
AA Change: M364K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000001652
Gene: ENSMUSG00000021070
AA Change: M364K

DomainStartEndE-ValueType
Pfam:7tm_1 75 333 8.8e-56 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for bradykinin. The 9 aa bradykinin peptide elicits many responses including vasodilation, edema, smooth muscle spasm and pain fiber stimulation. This receptor associates with G proteins that stimulate a phosphatidylinositol-calcium second messenger system. Alternate start codons result in two isoforms of the protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are indistinguishable from normal littermates, but bradykinin response is eliminated in ileum, uterus, and cervical ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik G A 3: 138,173,571 R239C possibly damaging Het
Aass T A 6: 23,093,908 D138V probably damaging Het
Adam30 T C 3: 98,162,290 S480P probably benign Het
Bnc2 T C 4: 84,546,335 D67G probably damaging Het
Cfap52 A G 11: 67,925,172 I595T probably damaging Het
Clspn A T 4: 126,577,779 N909Y possibly damaging Het
Ddx46 T C 13: 55,655,096 V477A possibly damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah3 A G 7: 120,078,445 S419P probably damaging Het
Fat3 A G 9: 16,006,615 F1504S probably damaging Het
Gm5724 C T 6: 141,712,133 G560S probably damaging Het
Guf1 G T 5: 69,567,212 V416L possibly damaging Het
Hsd11b2 A G 8: 105,523,151 D298G probably damaging Het
Mipol1 A T 12: 57,325,616 I154F probably damaging Het
Myo18b A G 5: 112,760,414 S1998P probably damaging Het
Myo6 C T 9: 80,288,021 T891M probably damaging Het
Nbeal1 T A 1: 60,312,226 I2461K probably damaging Het
Notch4 T C 17: 34,587,390 F1767S probably damaging Het
Olfr18 A T 9: 20,314,469 H150Q possibly damaging Het
Pi4ka A T 16: 17,389,352 S30T probably damaging Het
Ppp1r26 A G 2: 28,452,134 D592G probably damaging Het
Ptp4a2 T C 4: 129,847,787 F157L probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Shank3 T C 15: 89,549,371 S1365P probably damaging Het
Slc27a6 T A 18: 58,556,560 Y33N probably damaging Het
Speg T A 1: 75,415,138 S1572T possibly damaging Het
Taf6 G A 5: 138,182,687 R211C possibly damaging Het
Tyrobp T C 7: 30,414,608 S65P probably damaging Het
Other mutations in Bdkrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Bdkrb2 APN 12 105588303 splice site probably benign
IGL00703:Bdkrb2 APN 12 105592355 missense probably benign 0.04
R0465:Bdkrb2 UTSW 12 105591859 missense possibly damaging 0.89
R1171:Bdkrb2 UTSW 12 105592157 missense probably benign
R1589:Bdkrb2 UTSW 12 105591859 missense possibly damaging 0.94
R2265:Bdkrb2 UTSW 12 105592225 missense probably benign 0.00
R3404:Bdkrb2 UTSW 12 105592496 missense possibly damaging 0.90
R3406:Bdkrb2 UTSW 12 105592496 missense possibly damaging 0.90
R3857:Bdkrb2 UTSW 12 105592439 missense probably benign 0.08
R4761:Bdkrb2 UTSW 12 105588278 missense probably benign 0.00
R4833:Bdkrb2 UTSW 12 105591658 missense probably benign 0.10
R6916:Bdkrb2 UTSW 12 105591779 missense probably damaging 0.96
R7358:Bdkrb2 UTSW 12 105592541 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TTCCAGATCAGCACCTTCCTGGAC -3'
(R):5'- GGATGCTTCAAGCTCCTTCCTGAAC -3'

Sequencing Primer
(F):5'- ACCTTCCTGGACACGCTG -3'
(R):5'- TTCCTGAACCCAGGCTGAG -3'
Posted On2013-11-18