Incidental Mutation 'R1082:Ddx46'
ID85880
Institutional Source Beutler Lab
Gene Symbol Ddx46
Ensembl Gene ENSMUSG00000021500
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 46
Synonyms
MMRRC Submission 039168-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R1082 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location55635027-55681256 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55655096 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 477 (V477A)
Ref Sequence ENSEMBL: ENSMUSP00000153328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099479] [ENSMUST00000172272] [ENSMUST00000223736]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099479
AA Change: V477A

PolyPhen 2 Score 0.715 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097078
Gene: ENSMUSG00000021500
AA Change: V477A

DomainStartEndE-ValueType
low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 4e-76 BLAST
DEXDc 391 592 3.27e-49 SMART
HELICc 629 710 1.55e-27 SMART
low complexity region 760 776 N/A INTRINSIC
low complexity region 798 813 N/A INTRINSIC
internal_repeat_1 855 894 6.68e-7 PROSPERO
low complexity region 911 925 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172272
AA Change: V477A

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133245
Gene: ENSMUSG00000021500
AA Change: V477A

DomainStartEndE-ValueType
low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 5e-76 BLAST
DEXDc 391 596 8.03e-67 SMART
HELICc 633 714 1.55e-27 SMART
low complexity region 764 780 N/A INTRINSIC
low complexity region 802 817 N/A INTRINSIC
internal_repeat_1 859 898 1.04e-6 PROSPERO
low complexity region 915 929 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223736
AA Change: V477A

PolyPhen 2 Score 0.874 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224551
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAD box protein family. DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a component of the 17S U2 snRNP complex; it plays an important role in pre-mRNA splicing. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik G A 3: 138,173,571 R239C possibly damaging Het
Aass T A 6: 23,093,908 D138V probably damaging Het
Adam30 T C 3: 98,162,290 S480P probably benign Het
Bdkrb2 T A 12: 105,592,592 M364K probably benign Het
Bnc2 T C 4: 84,546,335 D67G probably damaging Het
Cfap52 A G 11: 67,925,172 I595T probably damaging Het
Clspn A T 4: 126,577,779 N909Y possibly damaging Het
Dna2 C T 10: 62,949,187 R28W probably benign Het
Dnah3 A G 7: 120,078,445 S419P probably damaging Het
Fat3 A G 9: 16,006,615 F1504S probably damaging Het
Gm5724 C T 6: 141,712,133 G560S probably damaging Het
Guf1 G T 5: 69,567,212 V416L possibly damaging Het
Hsd11b2 A G 8: 105,523,151 D298G probably damaging Het
Mipol1 A T 12: 57,325,616 I154F probably damaging Het
Myo18b A G 5: 112,760,414 S1998P probably damaging Het
Myo6 C T 9: 80,288,021 T891M probably damaging Het
Nbeal1 T A 1: 60,312,226 I2461K probably damaging Het
Notch4 T C 17: 34,587,390 F1767S probably damaging Het
Olfr18 A T 9: 20,314,469 H150Q possibly damaging Het
Pi4ka A T 16: 17,389,352 S30T probably damaging Het
Ppp1r26 A G 2: 28,452,134 D592G probably damaging Het
Ptp4a2 T C 4: 129,847,787 F157L probably benign Het
Sf3b1 C G 1: 55,019,395 E12Q possibly damaging Het
Shank3 T C 15: 89,549,371 S1365P probably damaging Het
Slc27a6 T A 18: 58,556,560 Y33N probably damaging Het
Speg T A 1: 75,415,138 S1572T possibly damaging Het
Taf6 G A 5: 138,182,687 R211C possibly damaging Het
Tyrobp T C 7: 30,414,608 S65P probably damaging Het
Other mutations in Ddx46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Ddx46 APN 13 55666332 nonsense probably null
IGL01137:Ddx46 APN 13 55669717 nonsense probably null
IGL01432:Ddx46 APN 13 55638022 splice site probably benign
IGL01575:Ddx46 APN 13 55654183 splice site probably benign
IGL01673:Ddx46 APN 13 55653048 missense probably damaging 1.00
IGL01868:Ddx46 APN 13 55639870 nonsense probably null
IGL01945:Ddx46 APN 13 55655072 nonsense probably null
IGL02106:Ddx46 APN 13 55677603 unclassified probably benign
IGL03288:Ddx46 APN 13 55638094 missense unknown
R0270:Ddx46 UTSW 13 55674104 missense probably benign 0.00
R0631:Ddx46 UTSW 13 55639777 splice site probably benign
R1502:Ddx46 UTSW 13 55663309 missense possibly damaging 0.89
R2081:Ddx46 UTSW 13 55674016 missense probably benign 0.00
R2256:Ddx46 UTSW 13 55647708 missense possibly damaging 0.50
R4366:Ddx46 UTSW 13 55663236 missense probably benign 0.10
R4856:Ddx46 UTSW 13 55638199 missense unknown
R4886:Ddx46 UTSW 13 55638199 missense unknown
R5001:Ddx46 UTSW 13 55652919 missense probably damaging 0.98
R5152:Ddx46 UTSW 13 55659030 missense probably damaging 1.00
R5258:Ddx46 UTSW 13 55653024 missense possibly damaging 0.95
R5278:Ddx46 UTSW 13 55676038 missense probably damaging 0.97
R5806:Ddx46 UTSW 13 55663337 missense possibly damaging 0.93
R6627:Ddx46 UTSW 13 55652935 missense probably benign 0.15
R6659:Ddx46 UTSW 13 55669724 missense probably damaging 1.00
R6838:Ddx46 UTSW 13 55639935 critical splice donor site probably null
R7235:Ddx46 UTSW 13 55663240 missense probably benign 0.01
R7537:Ddx46 UTSW 13 55650478 missense probably damaging 1.00
R7664:Ddx46 UTSW 13 55659051 missense probably damaging 1.00
R7673:Ddx46 UTSW 13 55659159 missense probably benign 0.01
R7704:Ddx46 UTSW 13 55674019 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTACAAGGCACGGAGTCCTCTCG -3'
(R):5'- GGCACACAGGCACGTACTGTATTC -3'

Sequencing Primer
(F):5'- GCTTTGTAGCTCAAGGAGTCAC -3'
(R):5'- TTCTACAATTATTTCCCCACCAAAC -3'
Posted On2013-11-18