Incidental Mutation 'R0714:Slx1b'
ID85908
Institutional Source Beutler Lab
Gene Symbol Slx1b
Ensembl Gene ENSMUSG00000059772
Gene NameSLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae)
Synonyms4833422P03Rik, Giyd2, 1110030E23Rik, 2410170E21Rik
MMRRC Submission 038897-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0714 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126689468-126695784 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126692448 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 148 (I148N)
Ref Sequence ENSEMBL: ENSMUSP00000118182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106369] [ENSMUST00000130498] [ENSMUST00000142337] [ENSMUST00000144897]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084586
Predicted Effect probably benign
Transcript: ENSMUST00000106369
SMART Domains Protein: ENSMUSP00000101977
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 10 54 4.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122029
Predicted Effect probably benign
Transcript: ENSMUST00000130498
SMART Domains Protein: ENSMUSP00000114873
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 12 79 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142337
SMART Domains Protein: ENSMUSP00000117927
Gene: ENSMUSG00000059772

DomainStartEndE-ValueType
Pfam:GIY-YIG 10 58 1.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144571
Predicted Effect probably damaging
Transcript: ENSMUST00000144897
AA Change: I148N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118182
Gene: ENSMUSG00000059772
AA Change: I148N

DomainStartEndE-ValueType
GIYc 10 112 1.14e-3 SMART
low complexity region 152 163 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206275
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit mouse embryonic fibroblasts that are more sensitive to DNA interstrand corsslinking agents with increased cell death, chromatide breaks, radial structures and impaired resolution of Holliday junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b G A 19: 21,678,609 R85H probably damaging Het
Adamts13 A G 2: 26,986,985 probably benign Het
Alb T C 5: 90,462,806 S82P possibly damaging Het
Arhgap10 G A 8: 77,351,687 probably benign Het
Aspscr1 T A 11: 120,703,667 probably null Het
Capn3 A T 2: 120,491,880 Q359L probably benign Het
Ccdc110 A T 8: 45,943,010 D646V possibly damaging Het
Ccr2 G A 9: 124,105,929 G82D probably benign Het
Col6a4 A G 9: 106,017,903 probably benign Het
Dhx29 T C 13: 112,927,965 V58A possibly damaging Het
Dhx35 C A 2: 158,844,183 Q593K probably benign Het
Dmd T C X: 84,309,897 L2240P probably benign Het
Emc7 A G 2: 112,462,932 N162S possibly damaging Het
Exoc7 A T 11: 116,293,294 N483K probably benign Het
Fbxo34 T C 14: 47,530,029 V282A probably damaging Het
Fndc3c1 A T X: 106,425,366 Y1087* probably null Het
Kat2a A G 11: 100,711,352 V192A probably damaging Het
Larp7 T C 3: 127,547,184 D64G probably damaging Het
Lnx1 A G 5: 74,607,909 probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nckipsd C A 9: 108,814,134 probably benign Het
Ndufab1 A G 7: 122,096,737 probably benign Het
Nedd4 G A 9: 72,731,446 probably benign Het
Nrsn2 G A 2: 152,374,122 R54* probably null Het
Nt5dc3 T A 10: 86,812,374 V171E probably damaging Het
Nudt8 A G 19: 4,002,023 *211W probably null Het
Nxph4 A G 10: 127,526,939 S28P probably damaging Het
Olfr1015 A G 2: 85,786,399 D296G probably damaging Het
Olfr1048 A C 2: 86,236,154 L227R probably damaging Het
Olfr1307 A G 2: 111,944,553 V301A probably benign Het
Pcdhb15 A G 18: 37,474,621 Y302C probably damaging Het
Pkdrej A G 15: 85,815,511 S2075P possibly damaging Het
Sdhc A T 1: 171,129,919 probably benign Het
Sidt2 A G 9: 45,947,060 probably benign Het
Sik2 T C 9: 50,907,436 M413V probably benign Het
Slc5a4b A G 10: 76,081,507 F232L probably benign Het
Spag17 C G 3: 100,080,156 S1587R probably damaging Het
St13 T C 15: 81,383,027 D74G probably benign Het
St7l G A 3: 104,874,928 R207H probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tacc3 T C 5: 33,671,397 probably benign Het
Tbx22 G A X: 107,685,125 V421I probably benign Het
Tmc3 G A 7: 83,616,761 A705T possibly damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tonsl T C 15: 76,633,721 probably benign Het
Trpm6 T A 19: 18,838,087 I1179N possibly damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Utp23 T G 15: 51,882,269 V55G possibly damaging Het
Vps11 A G 9: 44,359,656 V143A possibly damaging Het
Vps50 G T 6: 3,571,105 V618F probably benign Het
Other mutations in Slx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0437:Slx1b UTSW 7 126692581 missense probably benign 0.02
R0601:Slx1b UTSW 7 126692640 missense probably damaging 1.00
R1457:Slx1b UTSW 7 126692796 missense probably damaging 0.98
R3975:Slx1b UTSW 7 126691807 missense probably damaging 1.00
R4757:Slx1b UTSW 7 126692529 missense probably benign
R4950:Slx1b UTSW 7 126691767 utr 3 prime probably benign
R6194:Slx1b UTSW 7 126692331 missense possibly damaging 0.80
R7334:Slx1b UTSW 7 126692527 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGAAAGAACTGCCCTCCTCATTAG -3'
(R):5'- TGGCAACATCCTCAAGCTTCACG -3'

Sequencing Primer
(F):5'- TCTGGCCTTGGTACCTAGAT -3'
(R):5'- TTCTGGCGCACATGCTT -3'
Posted On2013-11-18