Incidental Mutation 'R0714:Slx1b'
ID 85908
Institutional Source Beutler Lab
Gene Symbol Slx1b
Ensembl Gene ENSMUSG00000059772
Gene Name SLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae)
Synonyms 2410170E21Rik, 4833422P03Rik, Giyd2, 1110030E23Rik
MMRRC Submission 038897-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0714 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 126288640-126294956 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 126291620 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 148 (I148N)
Ref Sequence ENSEMBL: ENSMUSP00000118182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106369] [ENSMUST00000130498] [ENSMUST00000142337] [ENSMUST00000144897]
AlphaFold Q8BX32
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084586
Predicted Effect probably benign
Transcript: ENSMUST00000106369
SMART Domains Protein: ENSMUSP00000101977
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 10 54 4.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122029
Predicted Effect probably benign
Transcript: ENSMUST00000130498
SMART Domains Protein: ENSMUSP00000114873
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 12 79 1.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142337
SMART Domains Protein: ENSMUSP00000117927
Gene: ENSMUSG00000059772

DomainStartEndE-ValueType
Pfam:GIY-YIG 10 58 1.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144897
AA Change: I148N

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118182
Gene: ENSMUSG00000059772
AA Change: I148N

DomainStartEndE-ValueType
GIYc 10 112 1.14e-3 SMART
low complexity region 152 163 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144571
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit mouse embryonic fibroblasts that are more sensitive to DNA interstrand corsslinking agents with increased cell death, chromatide breaks, radial structures and impaired resolution of Holliday junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b G A 19: 21,655,973 (GRCm39) R85H probably damaging Het
Adamts13 A G 2: 26,876,997 (GRCm39) probably benign Het
Alb T C 5: 90,610,665 (GRCm39) S82P possibly damaging Het
Arhgap10 G A 8: 78,078,316 (GRCm39) probably benign Het
Aspscr1 T A 11: 120,594,493 (GRCm39) probably null Het
Capn3 A T 2: 120,322,361 (GRCm39) Q359L probably benign Het
Ccdc110 A T 8: 46,396,047 (GRCm39) D646V possibly damaging Het
Ccr2 G A 9: 123,905,966 (GRCm39) G82D probably benign Het
Col6a4 A G 9: 105,895,102 (GRCm39) probably benign Het
Dhx29 T C 13: 113,064,499 (GRCm39) V58A possibly damaging Het
Dhx35 C A 2: 158,686,103 (GRCm39) Q593K probably benign Het
Dmd T C X: 83,353,503 (GRCm39) L2240P probably benign Het
Emc7 A G 2: 112,293,277 (GRCm39) N162S possibly damaging Het
Exoc7 A T 11: 116,184,120 (GRCm39) N483K probably benign Het
Fbxo34 T C 14: 47,767,486 (GRCm39) V282A probably damaging Het
Fndc3c1 A T X: 105,468,972 (GRCm39) Y1087* probably null Het
Kat2a A G 11: 100,602,178 (GRCm39) V192A probably damaging Het
Larp7 T C 3: 127,340,833 (GRCm39) D64G probably damaging Het
Lnx1 A G 5: 74,768,570 (GRCm39) probably benign Het
Mib2 C T 4: 155,743,917 (GRCm39) G42S probably damaging Het
Nckipsd C A 9: 108,691,333 (GRCm39) probably benign Het
Ndufab1 A G 7: 121,695,960 (GRCm39) probably benign Het
Nedd4 G A 9: 72,638,728 (GRCm39) probably benign Het
Nrsn2 G A 2: 152,216,042 (GRCm39) R54* probably null Het
Nt5dc3 T A 10: 86,648,238 (GRCm39) V171E probably damaging Het
Nudt8 A G 19: 4,052,023 (GRCm39) *211W probably null Het
Nxph4 A G 10: 127,362,808 (GRCm39) S28P probably damaging Het
Or4f14b A G 2: 111,774,898 (GRCm39) V301A probably benign Het
Or8k17 A C 2: 86,066,498 (GRCm39) L227R probably damaging Het
Or9g4b A G 2: 85,616,743 (GRCm39) D296G probably damaging Het
Pcdhb15 A G 18: 37,607,674 (GRCm39) Y302C probably damaging Het
Pkdrej A G 15: 85,699,712 (GRCm39) S2075P possibly damaging Het
Sdhc A T 1: 170,957,488 (GRCm39) probably benign Het
Sidt2 A G 9: 45,858,358 (GRCm39) probably benign Het
Sik2 T C 9: 50,818,736 (GRCm39) M413V probably benign Het
Slc5a4b A G 10: 75,917,341 (GRCm39) F232L probably benign Het
Spag17 C G 3: 99,987,472 (GRCm39) S1587R probably damaging Het
St13 T C 15: 81,267,228 (GRCm39) D74G probably benign Het
St7l G A 3: 104,782,244 (GRCm39) R207H probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,144,734 (GRCm39) probably null Het
Tacc3 T C 5: 33,828,741 (GRCm39) probably benign Het
Tbx22 G A X: 106,728,731 (GRCm39) V421I probably benign Het
Tmc3 G A 7: 83,265,969 (GRCm39) A705T possibly damaging Het
Tmem130 C T 5: 144,674,619 (GRCm39) V369M probably damaging Het
Tonsl T C 15: 76,517,921 (GRCm39) probably benign Het
Trpm6 T A 19: 18,815,451 (GRCm39) I1179N possibly damaging Het
Ttc13 A T 8: 125,401,105 (GRCm39) S624T probably damaging Het
Utp23 T G 15: 51,745,665 (GRCm39) V55G possibly damaging Het
Vps11 A G 9: 44,270,953 (GRCm39) V143A possibly damaging Het
Vps50 G T 6: 3,571,105 (GRCm39) V618F probably benign Het
Other mutations in Slx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0437:Slx1b UTSW 7 126,291,753 (GRCm39) missense probably benign 0.02
R0601:Slx1b UTSW 7 126,291,812 (GRCm39) missense probably damaging 1.00
R1457:Slx1b UTSW 7 126,291,968 (GRCm39) missense probably damaging 0.98
R3975:Slx1b UTSW 7 126,290,979 (GRCm39) missense probably damaging 1.00
R4757:Slx1b UTSW 7 126,291,701 (GRCm39) missense probably benign
R4950:Slx1b UTSW 7 126,290,939 (GRCm39) utr 3 prime probably benign
R6194:Slx1b UTSW 7 126,291,503 (GRCm39) missense possibly damaging 0.80
R7334:Slx1b UTSW 7 126,291,699 (GRCm39) missense probably damaging 0.99
R9664:Slx1b UTSW 7 126,291,698 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAAAGAACTGCCCTCCTCATTAG -3'
(R):5'- TGGCAACATCCTCAAGCTTCACG -3'

Sequencing Primer
(F):5'- TCTGGCCTTGGTACCTAGAT -3'
(R):5'- TTCTGGCGCACATGCTT -3'
Posted On 2013-11-18