Incidental Mutation 'R0714:Ccdc110'
ID85909
Institutional Source Beutler Lab
Gene Symbol Ccdc110
Ensembl Gene ENSMUSG00000071104
Gene Namecoiled-coil domain containing 110
SynonymsLOC212392
MMRRC Submission 038897-MU
Accession Numbers

Genbank: NM_001033246; MGI: 2685018

Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0714 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location45934619-45944145 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45943010 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 646 (D646V)
Ref Sequence ENSEMBL: ENSMUSP00000092964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095326] [ENSMUST00000174815]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095326
AA Change: D646V

PolyPhen 2 Score 0.713 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000092964
Gene: ENSMUSG00000071104
AA Change: D646V

DomainStartEndE-ValueType
coiled coil region 442 794 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174815
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b G A 19: 21,678,609 R85H probably damaging Het
Adamts13 A G 2: 26,986,985 probably benign Het
Alb T C 5: 90,462,806 S82P possibly damaging Het
Arhgap10 G A 8: 77,351,687 probably benign Het
Aspscr1 T A 11: 120,703,667 probably null Het
Capn3 A T 2: 120,491,880 Q359L probably benign Het
Ccr2 G A 9: 124,105,929 G82D probably benign Het
Col6a4 A G 9: 106,017,903 probably benign Het
Dhx29 T C 13: 112,927,965 V58A possibly damaging Het
Dhx35 C A 2: 158,844,183 Q593K probably benign Het
Dmd T C X: 84,309,897 L2240P probably benign Het
Emc7 A G 2: 112,462,932 N162S possibly damaging Het
Exoc7 A T 11: 116,293,294 N483K probably benign Het
Fbxo34 T C 14: 47,530,029 V282A probably damaging Het
Fndc3c1 A T X: 106,425,366 Y1087* probably null Het
Kat2a A G 11: 100,711,352 V192A probably damaging Het
Larp7 T C 3: 127,547,184 D64G probably damaging Het
Lnx1 A G 5: 74,607,909 probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nckipsd C A 9: 108,814,134 probably benign Het
Ndufab1 A G 7: 122,096,737 probably benign Het
Nedd4 G A 9: 72,731,446 probably benign Het
Nrsn2 G A 2: 152,374,122 R54* probably null Het
Nt5dc3 T A 10: 86,812,374 V171E probably damaging Het
Nudt8 A G 19: 4,002,023 *211W probably null Het
Nxph4 A G 10: 127,526,939 S28P probably damaging Het
Olfr1015 A G 2: 85,786,399 D296G probably damaging Het
Olfr1048 A C 2: 86,236,154 L227R probably damaging Het
Olfr1307 A G 2: 111,944,553 V301A probably benign Het
Pcdhb15 A G 18: 37,474,621 Y302C probably damaging Het
Pkdrej A G 15: 85,815,511 S2075P possibly damaging Het
Sdhc A T 1: 171,129,919 probably benign Het
Sidt2 A G 9: 45,947,060 probably benign Het
Sik2 T C 9: 50,907,436 M413V probably benign Het
Slc5a4b A G 10: 76,081,507 F232L probably benign Het
Slx1b A T 7: 126,692,448 I148N probably damaging Het
Spag17 C G 3: 100,080,156 S1587R probably damaging Het
St13 T C 15: 81,383,027 D74G probably benign Het
St7l G A 3: 104,874,928 R207H probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tacc3 T C 5: 33,671,397 probably benign Het
Tbx22 G A X: 107,685,125 V421I probably benign Het
Tmc3 G A 7: 83,616,761 A705T possibly damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tonsl T C 15: 76,633,721 probably benign Het
Trpm6 T A 19: 18,838,087 I1179N possibly damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Utp23 T G 15: 51,882,269 V55G possibly damaging Het
Vps11 A G 9: 44,359,656 V143A possibly damaging Het
Vps50 G T 6: 3,571,105 V618F probably benign Het
Other mutations in Ccdc110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01898:Ccdc110 APN 8 45942124 missense possibly damaging 0.76
IGL02175:Ccdc110 APN 8 45940623 missense probably benign 0.07
IGL02471:Ccdc110 APN 8 45941756 missense probably benign 0.14
IGL02524:Ccdc110 APN 8 45941942 missense probably benign
IGL02887:Ccdc110 APN 8 45943184 missense probably benign 0.01
IGL03227:Ccdc110 APN 8 45941549 missense probably damaging 1.00
IGL03238:Ccdc110 APN 8 45941822 missense probably benign 0.00
droll UTSW 8 45942827 missense probably benign 0.10
humorless UTSW 8 45943450 missense probably benign 0.03
R0049:Ccdc110 UTSW 8 45942626 missense probably damaging 1.00
R0049:Ccdc110 UTSW 8 45942626 missense probably damaging 1.00
R0110:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0189:Ccdc110 UTSW 8 45935082 missense probably damaging 0.98
R0218:Ccdc110 UTSW 8 45934724 splice site probably benign
R0280:Ccdc110 UTSW 8 45943450 missense probably benign 0.03
R0332:Ccdc110 UTSW 8 45942964 nonsense probably null
R0371:Ccdc110 UTSW 8 45942806 missense possibly damaging 0.86
R0469:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0502:Ccdc110 UTSW 8 45934724 splice site probably benign
R0510:Ccdc110 UTSW 8 45935157 missense probably benign 0.00
R0534:Ccdc110 UTSW 8 45935138 missense possibly damaging 0.73
R0647:Ccdc110 UTSW 8 45943388 missense probably damaging 0.99
R0721:Ccdc110 UTSW 8 45941989 missense probably benign
R1029:Ccdc110 UTSW 8 45941780 missense probably damaging 0.98
R1147:Ccdc110 UTSW 8 45944084 missense possibly damaging 0.64
R1147:Ccdc110 UTSW 8 45944084 missense possibly damaging 0.64
R1170:Ccdc110 UTSW 8 45941885 missense probably benign 0.22
R1340:Ccdc110 UTSW 8 45942181 missense probably benign 0.02
R1540:Ccdc110 UTSW 8 45942325 nonsense probably null
R1587:Ccdc110 UTSW 8 45941746 missense probably benign 0.01
R1602:Ccdc110 UTSW 8 45938918 missense probably benign 0.12
R1629:Ccdc110 UTSW 8 45942127 missense probably benign 0.08
R1842:Ccdc110 UTSW 8 45940568 missense probably damaging 1.00
R1933:Ccdc110 UTSW 8 45943250 missense probably damaging 1.00
R1934:Ccdc110 UTSW 8 45943250 missense probably damaging 1.00
R2006:Ccdc110 UTSW 8 45943312 missense probably damaging 1.00
R2043:Ccdc110 UTSW 8 45942827 missense probably benign 0.10
R2093:Ccdc110 UTSW 8 45942077 missense probably damaging 1.00
R2165:Ccdc110 UTSW 8 45942839 missense probably benign 0.00
R3613:Ccdc110 UTSW 8 45942806 missense possibly damaging 0.86
R3923:Ccdc110 UTSW 8 45942389 missense probably damaging 1.00
R4648:Ccdc110 UTSW 8 45942668 missense possibly damaging 0.95
R4773:Ccdc110 UTSW 8 45943208 missense probably damaging 1.00
R4901:Ccdc110 UTSW 8 45943400 missense probably benign 0.35
R4911:Ccdc110 UTSW 8 45942907 missense probably benign 0.00
R4923:Ccdc110 UTSW 8 45943423 missense probably benign 0.29
R5104:Ccdc110 UTSW 8 45942692 missense probably damaging 0.99
R5561:Ccdc110 UTSW 8 45940609 missense probably benign 0.02
R5966:Ccdc110 UTSW 8 45942536 missense probably damaging 1.00
R5976:Ccdc110 UTSW 8 45943499 missense possibly damaging 0.71
R6141:Ccdc110 UTSW 8 45941770 missense possibly damaging 0.89
R6326:Ccdc110 UTSW 8 45942041 missense probably damaging 1.00
R6366:Ccdc110 UTSW 8 45943388 missense probably damaging 0.99
R6405:Ccdc110 UTSW 8 45941697 nonsense probably null
R6482:Ccdc110 UTSW 8 45942788 missense probably benign 0.00
R6815:Ccdc110 UTSW 8 45941987 missense probably benign 0.19
R7387:Ccdc110 UTSW 8 45942196 missense probably benign 0.00
R7680:Ccdc110 UTSW 8 45941651 missense possibly damaging 0.64
R8099:Ccdc110 UTSW 8 45942093 missense probably damaging 1.00
R8114:Ccdc110 UTSW 8 45943103 missense probably damaging 1.00
R8151:Ccdc110 UTSW 8 45942793 missense probably damaging 1.00
R8295:Ccdc110 UTSW 8 45943379 missense probably damaging 0.97
X0053:Ccdc110 UTSW 8 45942961 missense possibly damaging 0.56
X0054:Ccdc110 UTSW 8 45941843 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTCAGCACTTACAACGTCCTC -3'
(R):5'- AGATGCTTGTCTCCGACTTTGCAC -3'

Sequencing Primer
(F):5'- TAGTCAGCTCTCTCTGGAAAAGC -3'
(R):5'- GCACTCTTGATTTCTTTCAGGAAC -3'
Posted On2013-11-18