Incidental Mutation 'R0714:Kat2a'
ID85921
Institutional Source Beutler Lab
Gene Symbol Kat2a
Ensembl Gene ENSMUSG00000020918
Gene NameK(lysine) acetyltransferase 2A
SynonymsGcn5, PCAF-B/GCN5, 1110051E14Rik, Gcn5l2
MMRRC Submission 038897-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0714 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100704746-100712465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100711352 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 192 (V192A)
Ref Sequence ENSEMBL: ENSMUSP00000006973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006973] [ENSMUST00000017976] [ENSMUST00000019317] [ENSMUST00000103118] [ENSMUST00000107364] [ENSMUST00000169833]
Predicted Effect probably damaging
Transcript: ENSMUST00000006973
AA Change: V192A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006973
Gene: ENSMUSG00000020918
AA Change: V192A

DomainStartEndE-ValueType
low complexity region 21 72 N/A INTRINSIC
Pfam:PCAF_N 81 332 1.2e-155 PFAM
low complexity region 398 417 N/A INTRINSIC
Pfam:Acetyltransf_7 538 621 5e-13 PFAM
Pfam:Acetyltransf_1 545 620 3.2e-11 PFAM
low complexity region 659 675 N/A INTRINSIC
BROMO 718 826 6.87e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000017976
SMART Domains Protein: ENSMUSP00000017976
Gene: ENSMUSG00000017832

DomainStartEndE-ValueType
Pfam:HSP20 52 149 4.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019317
SMART Domains Protein: ENSMUSP00000019317
Gene: ENSMUSG00000019173

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RAB 22 203 6.29e-85 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000103118
AA Change: V192A

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099407
Gene: ENSMUSG00000020918
AA Change: V192A

DomainStartEndE-ValueType
low complexity region 21 72 N/A INTRINSIC
Pfam:PCAF_N 81 331 4.4e-120 PFAM
low complexity region 398 417 N/A INTRINSIC
Pfam:Acetyltransf_7 539 622 1.2e-11 PFAM
Pfam:Acetyltransf_1 547 621 3.1e-11 PFAM
low complexity region 660 676 N/A INTRINSIC
BROMO 719 827 6.87e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107364
SMART Domains Protein: ENSMUSP00000102987
Gene: ENSMUSG00000019173

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
RAB 22 185 3.37e-94 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153526
Predicted Effect probably benign
Transcript: ENSMUST00000169833
SMART Domains Protein: ENSMUSP00000130551
Gene: ENSMUSG00000017832

DomainStartEndE-ValueType
Pfam:HSP20 83 178 1.2e-13 PFAM
Meta Mutation Damage Score 0.5140 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] KAT2A, or GCN5, is a histone acetyltransferase (HAT) that functions primarily as a transcriptional activator. It also functions as a repressor of NF-kappa-B (see MIM 164011) by promoting ubiquitination of the NF-kappa-B subunit RELA (MIM 164014) in a HAT-independent manner (Mao et al., 2009 [PubMed 19339690]).[supplied by OMIM, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit poorly developed yolk sac blood vessels, retarded growth, absence of dorsal mesoderm lineages, failure to form somites, and lethality between embryonic days 9.5-11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd17b G A 19: 21,678,609 R85H probably damaging Het
Adamts13 A G 2: 26,986,985 probably benign Het
Alb T C 5: 90,462,806 S82P possibly damaging Het
Arhgap10 G A 8: 77,351,687 probably benign Het
Aspscr1 T A 11: 120,703,667 probably null Het
Capn3 A T 2: 120,491,880 Q359L probably benign Het
Ccdc110 A T 8: 45,943,010 D646V possibly damaging Het
Ccr2 G A 9: 124,105,929 G82D probably benign Het
Col6a4 A G 9: 106,017,903 probably benign Het
Dhx29 T C 13: 112,927,965 V58A possibly damaging Het
Dhx35 C A 2: 158,844,183 Q593K probably benign Het
Dmd T C X: 84,309,897 L2240P probably benign Het
Emc7 A G 2: 112,462,932 N162S possibly damaging Het
Exoc7 A T 11: 116,293,294 N483K probably benign Het
Fbxo34 T C 14: 47,530,029 V282A probably damaging Het
Fndc3c1 A T X: 106,425,366 Y1087* probably null Het
Larp7 T C 3: 127,547,184 D64G probably damaging Het
Lnx1 A G 5: 74,607,909 probably benign Het
Mib2 C T 4: 155,659,460 G42S probably damaging Het
Nckipsd C A 9: 108,814,134 probably benign Het
Ndufab1 A G 7: 122,096,737 probably benign Het
Nedd4 G A 9: 72,731,446 probably benign Het
Nrsn2 G A 2: 152,374,122 R54* probably null Het
Nt5dc3 T A 10: 86,812,374 V171E probably damaging Het
Nudt8 A G 19: 4,002,023 *211W probably null Het
Nxph4 A G 10: 127,526,939 S28P probably damaging Het
Olfr1015 A G 2: 85,786,399 D296G probably damaging Het
Olfr1048 A C 2: 86,236,154 L227R probably damaging Het
Olfr1307 A G 2: 111,944,553 V301A probably benign Het
Pcdhb15 A G 18: 37,474,621 Y302C probably damaging Het
Pkdrej A G 15: 85,815,511 S2075P possibly damaging Het
Sdhc A T 1: 171,129,919 probably benign Het
Sidt2 A G 9: 45,947,060 probably benign Het
Sik2 T C 9: 50,907,436 M413V probably benign Het
Slc5a4b A G 10: 76,081,507 F232L probably benign Het
Slx1b A T 7: 126,692,448 I148N probably damaging Het
Spag17 C G 3: 100,080,156 S1587R probably damaging Het
St13 T C 15: 81,383,027 D74G probably benign Het
St7l G A 3: 104,874,928 R207H probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tacc3 T C 5: 33,671,397 probably benign Het
Tbx22 G A X: 107,685,125 V421I probably benign Het
Tmc3 G A 7: 83,616,761 A705T possibly damaging Het
Tmem130 C T 5: 144,737,809 V369M probably damaging Het
Tonsl T C 15: 76,633,721 probably benign Het
Trpm6 T A 19: 18,838,087 I1179N possibly damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Utp23 T G 15: 51,882,269 V55G possibly damaging Het
Vps11 A G 9: 44,359,656 V143A possibly damaging Het
Vps50 G T 6: 3,571,105 V618F probably benign Het
Other mutations in Kat2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kat2a APN 11 100705384 missense probably damaging 1.00
IGL00476:Kat2a APN 11 100705384 missense probably damaging 1.00
IGL00952:Kat2a APN 11 100706151 missense probably damaging 0.98
IGL01529:Kat2a APN 11 100711909 missense probably damaging 1.00
IGL02424:Kat2a APN 11 100711147 unclassified probably null
IGL03338:Kat2a APN 11 100711475 missense probably benign 0.30
R0096:Kat2a UTSW 11 100706471 missense probably damaging 1.00
R0711:Kat2a UTSW 11 100706471 missense probably damaging 1.00
R0784:Kat2a UTSW 11 100710841 missense probably benign 0.05
R1652:Kat2a UTSW 11 100708611 missense probably damaging 0.98
R2152:Kat2a UTSW 11 100712346 unclassified probably benign
R2177:Kat2a UTSW 11 100710822 missense probably damaging 1.00
R2510:Kat2a UTSW 11 100712142 missense probably benign 0.32
R2570:Kat2a UTSW 11 100710822 missense probably damaging 1.00
R4175:Kat2a UTSW 11 100705266 missense probably damaging 1.00
R4965:Kat2a UTSW 11 100712203 unclassified probably benign
R4965:Kat2a UTSW 11 100712204 unclassified probably benign
R5316:Kat2a UTSW 11 100712170 missense possibly damaging 0.77
R5732:Kat2a UTSW 11 100708240 missense probably damaging 1.00
R5954:Kat2a UTSW 11 100708898 missense possibly damaging 0.89
R6618:Kat2a UTSW 11 100712370 unclassified probably benign
R6719:Kat2a UTSW 11 100712141 missense probably benign 0.00
R6731:Kat2a UTSW 11 100708273 missense probably damaging 0.98
R7291:Kat2a UTSW 11 100710900 missense possibly damaging 0.55
R7373:Kat2a UTSW 11 100708566 missense probably benign 0.00
R7632:Kat2a UTSW 11 100708596 nonsense probably null
R8305:Kat2a UTSW 11 100709478 missense possibly damaging 0.77
R8322:Kat2a UTSW 11 100712290 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTCAGCAAACACCATGTCCCTTC -3'
(R):5'- GCCCTAATGTAACCATCTTGCAGCG -3'

Sequencing Primer
(F):5'- CTGTTCTCAGCTTGAGGAAATAAACC -3'
(R):5'- TGCAGCGGACCATGTGTC -3'
Posted On2013-11-18