Mutagenetix > Incidental Mutations

Incidental Mutation 'R0714:Tonsl'

85929

Institutional Source

Beutler Lab

Gene Symbol

Tonsl

Ensembl Gene

ENSMUSG00000059323

Gene Name

tonsoku-like, DNA repair protein

Synonyms

Nfkbil2, 2810439M11Rik

MMRRC Submission

038897-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0714 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

76626002-76639958 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 76633721 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000129597 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165190] [ENSMUST00000168185]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163161

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163990

Predicted Effect

probably benign
Transcript: ENSMUST00000165163

SMART Domains

Protein: ENSMUSP00000131229
Gene: ENSMUSG00000059323

Domain	Start	End	E-Value	Type
low complexity region	33	51	N/A	INTRINSIC
low complexity region	52	62	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165190

SMART Domains

Protein: ENSMUSP00000131368
Gene: ENSMUSG00000059323

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	4e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
low complexity region	259	271	N/A	INTRINSIC
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168185

SMART Domains

Protein: ENSMUSP00000129597
Gene: ENSMUSG00000059323

Domain	Start	End	E-Value	Type
TPR	27	60	5.33e1	SMART
Blast:TPR	67	100	7e-9	BLAST
TPR	162	195	1.77e1	SMART
TPR	202	235	1.36e1	SMART
Pfam:TPR_8	242	274	8.7e-3	PFAM
TPR	311	344	1.4e1	SMART
TPR	352	385	7.27e0	SMART
low complexity region	413	437	N/A	INTRINSIC
low complexity region	465	494	N/A	INTRINSIC
low complexity region	500	511	N/A	INTRINSIC
ANK	528	559	8.36e1	SMART
ANK	561	590	4.85e-8	SMART
ANK	597	626	2.85e-5	SMART
low complexity region	690	707	N/A	INTRINSIC
low complexity region	729	753	N/A	INTRINSIC
low complexity region	1031	1044	N/A	INTRINSIC
LRR	1058	1085	2.86e-1	SMART
LRR	1086	1113	5.88e-1	SMART
LRR	1117	1144	1.67e-2	SMART
LRR	1177	1204	2.72e0	SMART
LRR	1236	1263	7.02e0	SMART
LRR	1264	1292	1.46e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168432

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171478

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a negative regulator of NF-kappa-B mediated transcription. The encoded protein may bind NF-kappa-B complexes and trap them in the cytoplasm, preventing them from entering the nucleus and interacting with the DNA. Phosphorylation of this protein targets it for degradation by the ubiquitination pathway, which frees the NF-kappa-B complexes to enter the nucleus. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abhd17b	G	A	19: 21,678,609	R85H	probably damaging	Het
Adamts13	A	G	2: 26,986,985		probably benign	Het
Alb	T	C	5: 90,462,806	S82P	possibly damaging	Het
Arhgap10	G	A	8: 77,351,687		probably benign	Het
Aspscr1	T	A	11: 120,703,667		probably null	Het
Capn3	A	T	2: 120,491,880	Q359L	probably benign	Het
Ccdc110	A	T	8: 45,943,010	D646V	possibly damaging	Het
Ccr2	G	A	9: 124,105,929	G82D	probably benign	Het
Col6a4	A	G	9: 106,017,903		probably benign	Het
Dhx29	T	C	13: 112,927,965	V58A	possibly damaging	Het
Dhx35	C	A	2: 158,844,183	Q593K	probably benign	Het
Dmd	T	C	X: 84,309,897	L2240P	probably benign	Het
Emc7	A	G	2: 112,462,932	N162S	possibly damaging	Het
Exoc7	A	T	11: 116,293,294	N483K	probably benign	Het
Fbxo34	T	C	14: 47,530,029	V282A	probably damaging	Het
Fndc3c1	A	T	X: 106,425,366	Y1087*	probably null	Het
Kat2a	A	G	11: 100,711,352	V192A	probably damaging	Het
Larp7	T	C	3: 127,547,184	D64G	probably damaging	Het
Lnx1	A	G	5: 74,607,909		probably benign	Het
Mib2	C	T	4: 155,659,460	G42S	probably damaging	Het
Nckipsd	C	A	9: 108,814,134		probably benign	Het
Ndufab1	A	G	7: 122,096,737		probably benign	Het
Nedd4	G	A	9: 72,731,446		probably benign	Het
Nrsn2	G	A	2: 152,374,122	R54*	probably null	Het
Nt5dc3	T	A	10: 86,812,374	V171E	probably damaging	Het
Nudt8	A	G	19: 4,002,023	*211W	probably null	Het
Nxph4	A	G	10: 127,526,939	S28P	probably damaging	Het
Olfr1015	A	G	2: 85,786,399	D296G	probably damaging	Het
Olfr1048	A	C	2: 86,236,154	L227R	probably damaging	Het
Olfr1307	A	G	2: 111,944,553	V301A	probably benign	Het
Pcdhb15	A	G	18: 37,474,621	Y302C	probably damaging	Het
Pkdrej	A	G	15: 85,815,511	S2075P	possibly damaging	Het
Sdhc	A	T	1: 171,129,919		probably benign	Het
Sidt2	A	G	9: 45,947,060		probably benign	Het
Sik2	T	C	9: 50,907,436	M413V	probably benign	Het
Slc5a4b	A	G	10: 76,081,507	F232L	probably benign	Het
Slx1b	A	T	7: 126,692,448	I148N	probably damaging	Het
Spag17	C	G	3: 100,080,156	S1587R	probably damaging	Het
St13	T	C	15: 81,383,027	D74G	probably benign	Het
St7l	G	A	3: 104,874,928	R207H	probably benign	Het
Syne2	AGAGTGAG	AGAGTGAGTGAG	12: 76,097,960		probably null	Het
Tacc3	T	C	5: 33,671,397		probably benign	Het
Tbx22	G	A	X: 107,685,125	V421I	probably benign	Het
Tmc3	G	A	7: 83,616,761	A705T	possibly damaging	Het
Tmem130	C	T	5: 144,737,809	V369M	probably damaging	Het
Trpm6	T	A	19: 18,838,087	I1179N	possibly damaging	Het
Ttc13	A	T	8: 124,674,366	S624T	probably damaging	Het
Utp23	T	G	15: 51,882,269	V55G	possibly damaging	Het
Vps11	A	G	9: 44,359,656	V143A	possibly damaging	Het
Vps50	G	T	6: 3,571,105	V618F	probably benign	Het

Other mutations in Tonsl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00093:Tonsl	APN	15	76638496	missense	possibly damaging	0.78
IGL00763:Tonsl	APN	15	76633868	missense	probably damaging	1.00
IGL00796:Tonsl	APN	15	76625149	missense	probably benign
IGL00965:Tonsl	APN	15	76631880	splice site	probably benign
IGL01434:Tonsl	APN	15	76631102	missense	probably benign	0.11
IGL01859:Tonsl	APN	15	76634780	missense	probably damaging	0.97
IGL02112:Tonsl	APN	15	76633402	missense	probably benign	0.01
IGL02189:Tonsl	APN	15	76623178	missense	possibly damaging	0.56
IGL02281:Tonsl	APN	15	76634074	missense	probably damaging	1.00
IGL02627:Tonsl	APN	15	76634095	missense	probably damaging	0.99
IGL02750:Tonsl	APN	15	76633389	missense	probably damaging	0.97
IGL02977:Tonsl	APN	15	76632873	missense	probably benign	0.00
R0127:Tonsl	UTSW	15	76633485	missense	probably benign	0.01
R0316:Tonsl	UTSW	15	76629300	missense	possibly damaging	0.68
R0443:Tonsl	UTSW	15	76639684	missense	probably benign
R0946:Tonsl	UTSW	15	76623221	missense	probably benign	0.03
R0975:Tonsl	UTSW	15	76638932	missense	probably damaging	0.99
R1263:Tonsl	UTSW	15	76622562	missense	possibly damaging	0.85
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1468:Tonsl	UTSW	15	76636561	critical splice donor site	probably null
R1610:Tonsl	UTSW	15	76638557	missense	probably damaging	1.00
R1623:Tonsl	UTSW	15	76638509	missense	probably damaging	1.00
R1763:Tonsl	UTSW	15	76638066	missense	probably damaging	1.00
R1882:Tonsl	UTSW	15	76624150	missense	possibly damaging	0.83
R1898:Tonsl	UTSW	15	76638853	splice site	probably null
R1932:Tonsl	UTSW	15	76624597	missense	probably damaging	0.97
R2141:Tonsl	UTSW	15	76632661	missense	probably damaging	0.99
R2166:Tonsl	UTSW	15	76637313	missense	probably benign	0.13
R2191:Tonsl	UTSW	15	76632680	missense	probably damaging	0.96
R2198:Tonsl	UTSW	15	76636672	missense	probably benign	0.00
R2219:Tonsl	UTSW	15	76634640	missense	probably damaging	1.00
R2762:Tonsl	UTSW	15	76630620	missense	probably damaging	1.00
R3156:Tonsl	UTSW	15	76639521	missense	probably damaging	1.00
R3508:Tonsl	UTSW	15	76639756	missense	probably benign
R4012:Tonsl	UTSW	15	76637044	missense	probably damaging	1.00
R4179:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4180:Tonsl	UTSW	15	76624475	missense	probably damaging	1.00
R4327:Tonsl	UTSW	15	76639716	missense	probably benign
R4627:Tonsl	UTSW	15	76637224	missense	probably damaging	1.00
R4671:Tonsl	UTSW	15	76623410	missense	probably benign	0.01
R4825:Tonsl	UTSW	15	76633248	missense	probably benign	0.34
R4840:Tonsl	UTSW	15	76633209	missense	probably benign
R5030:Tonsl	UTSW	15	76638101	missense	probably damaging	1.00
R5143:Tonsl	UTSW	15	76636657	missense	possibly damaging	0.80
R6238:Tonsl	UTSW	15	76636218	splice site	probably null
R6379:Tonsl	UTSW	15	76629742	missense	probably benign
R6401:Tonsl	UTSW	15	76633666	missense	probably damaging	1.00
R6534:Tonsl	UTSW	15	76629677	missense	probably damaging	1.00
R6695:Tonsl	UTSW	15	76629818	missense	possibly damaging	0.84
R6701:Tonsl	UTSW	15	76629300	missense	probably damaging	1.00
R7138:Tonsl	UTSW	15	76634776	missense	probably benign
R7206:Tonsl	UTSW	15	76633651	missense	probably damaging	1.00
R7287:Tonsl	UTSW	15	76633725	splice site	probably null
R7615:Tonsl	UTSW	15	76630607	missense	probably benign	0.44
R7626:Tonsl	UTSW	15	76633936	missense	probably null	1.00
R7641:Tonsl	UTSW	15	76633652	missense	probably damaging	1.00
R7920:Tonsl	UTSW	15	76634587	missense	probably damaging	1.00
R8245:Tonsl	UTSW	15	76636822	missense	probably benign	0.10
R8311:Tonsl	UTSW	15	76633263	missense	probably benign
Z1177:Tonsl	UTSW	15	76636153	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- GGCAGACACAGTTTCCTCCAGAAAG -3'
(R):5'- GCAAGTACGAATGTGCTCACCACC -3'

Sequencing Primer
(F):5'- cctcacttttagggctaggaac -3'
(R):5'- CCCACCCAGAGATTGTTCG -3'

Posted On

2013-11-18