Incidental Mutation 'R1063:Ces1a'
ID85942
Institutional Source Beutler Lab
Gene Symbol Ces1a
Ensembl Gene ENSMUSG00000071047
Gene Namecarboxylesterase 1A
SynonymsGm4976
MMRRC Submission 039149-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1063 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location93020214-93048192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93022416 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 456 (D456N)
Ref Sequence ENSEMBL: ENSMUSP00000092836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095211]
Predicted Effect probably benign
Transcript: ENSMUST00000095211
AA Change: D456N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000092836
Gene: ENSMUSG00000071047
AA Change: D456N

DomainStartEndE-ValueType
Pfam:COesterase 1 545 5.7e-169 PFAM
Pfam:Abhydrolase_3 136 286 8.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210764
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.1%
  • 10x: 97.6%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 3 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1 G A 17: 35,172,151 P44L probably benign Het
Cdo1 T C 18: 46,728,063 E27G probably benign Het
F5 G C 1: 164,198,917 R1686P probably damaging Het
Other mutations in Ces1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Ces1a APN 8 93020467 missense probably damaging 1.00
IGL00556:Ces1a APN 8 93045059 missense probably benign 0.03
IGL00841:Ces1a APN 8 93039536 nonsense probably null
IGL01510:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01511:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01518:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01519:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01520:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01526:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01527:Ces1a APN 8 93045098 missense probably damaging 1.00
IGL01828:Ces1a APN 8 93025201 missense probably damaging 0.96
IGL01934:Ces1a APN 8 93032650 missense probably damaging 0.99
IGL02456:Ces1a APN 8 93039498 missense possibly damaging 0.56
IGL02712:Ces1a APN 8 93036040 missense probably damaging 1.00
IGL02982:Ces1a APN 8 93044975 missense probably damaging 1.00
IGL03178:Ces1a APN 8 93020889 missense probably damaging 1.00
IGL03377:Ces1a APN 8 93039488 missense probably damaging 1.00
R0556:Ces1a UTSW 8 93045112 missense probably benign 0.01
R0613:Ces1a UTSW 8 93025581 missense probably benign 0.11
R0627:Ces1a UTSW 8 93042043 missense probably benign 0.03
R0686:Ces1a UTSW 8 93022449 missense probably damaging 1.00
R0724:Ces1a UTSW 8 93039513 missense probably damaging 0.98
R0930:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1215:Ces1a UTSW 8 93032690 missense probably damaging 1.00
R1381:Ces1a UTSW 8 93034031 missense probably damaging 0.98
R1417:Ces1a UTSW 8 93022416 missense probably benign 0.00
R1850:Ces1a UTSW 8 93027326 missense probably damaging 1.00
R2072:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2074:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2075:Ces1a UTSW 8 93048075 missense probably benign 0.29
R2114:Ces1a UTSW 8 93039551 missense possibly damaging 0.93
R2213:Ces1a UTSW 8 93025225 missense probably damaging 1.00
R2346:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2347:Ces1a UTSW 8 93025319 missense probably benign 0.07
R2483:Ces1a UTSW 8 93027341 missense probably damaging 1.00
R4515:Ces1a UTSW 8 93020904 missense probably damaging 1.00
R4587:Ces1a UTSW 8 93025304 missense probably damaging 1.00
R4691:Ces1a UTSW 8 93032659 missense probably benign 0.00
R4992:Ces1a UTSW 8 93045022 missense probably benign 0.08
R5074:Ces1a UTSW 8 93032675 missense possibly damaging 0.77
R6086:Ces1a UTSW 8 93027353 missense probably benign 0.03
R7390:Ces1a UTSW 8 93044841 intron probably null
Z1088:Ces1a UTSW 8 93025607 missense probably benign 0.02
Z1176:Ces1a UTSW 8 93036085 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- GGATCATGAGGGTGACTACTTTGGC -3'
(R):5'- AAGCTGTGTTTCCCTTCTAGCTGTG -3'

Sequencing Primer
(F):5'- cagtgtgaccagccaacc -3'
(R):5'- GGATTTTCAGTGACTTTATACCACC -3'
Posted On2013-11-18