Incidental Mutation 'R1065:Stkld1'
ID85950
Institutional Source Beutler Lab
Gene Symbol Stkld1
Ensembl Gene ENSMUSG00000049897
Gene Nameserine/threonine kinase-like domain containing 1
SynonymsLOC279029, Gm711
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26934047-26953496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26940038 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 72 (N72I)
Ref Sequence ENSEMBL: ENSMUSP00000121332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055406] [ENSMUST00000153771]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055406
AA Change: N64I

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062967
Gene: ENSMUSG00000049897
AA Change: N64I

DomainStartEndE-ValueType
Pfam:Pkinase 3 266 8e-35 PFAM
Pfam:Pkinase_Tyr 7 262 4.5e-27 PFAM
low complexity region 352 366 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153771
AA Change: N72I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121332
Gene: ENSMUSG00000049897
AA Change: N72I

DomainStartEndE-ValueType
Pfam:Pkinase 4 116 2.3e-8 PFAM
Pfam:Pkinase_Tyr 6 115 4.6e-6 PFAM
Meta Mutation Damage Score 0.2826 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Stkld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Stkld1 APN 2 26951471 missense probably benign 0.01
IGL02183:Stkld1 APN 2 26946659 missense probably benign 0.04
IGL02393:Stkld1 APN 2 26950142 missense probably benign 0.41
IGL03136:Stkld1 APN 2 26951423 missense probably benign 0.00
IGL03261:Stkld1 APN 2 26952777 missense probably benign 0.21
R0067:Stkld1 UTSW 2 26949340 missense probably benign 0.01
R0067:Stkld1 UTSW 2 26949340 missense probably benign 0.01
R0973:Stkld1 UTSW 2 26951450 missense probably benign 0.00
R1467:Stkld1 UTSW 2 26949395 missense probably benign 0.00
R1467:Stkld1 UTSW 2 26949395 missense probably benign 0.00
R1565:Stkld1 UTSW 2 26950090 missense probably benign 0.00
R1844:Stkld1 UTSW 2 26950103 missense probably damaging 1.00
R1871:Stkld1 UTSW 2 26937973 unclassified probably benign
R1965:Stkld1 UTSW 2 26946732 unclassified probably null
R2001:Stkld1 UTSW 2 26952747 missense probably damaging 1.00
R2308:Stkld1 UTSW 2 26952714 missense probably damaging 0.98
R2566:Stkld1 UTSW 2 26950638 missense probably damaging 1.00
R3929:Stkld1 UTSW 2 26940047 critical splice donor site probably null
R4257:Stkld1 UTSW 2 26943134 missense probably benign 0.02
R4493:Stkld1 UTSW 2 26946626 missense probably benign 0.00
R4494:Stkld1 UTSW 2 26946626 missense probably benign 0.00
R4589:Stkld1 UTSW 2 26950667 missense probably damaging 1.00
R4775:Stkld1 UTSW 2 26951745 missense probably damaging 0.99
R5601:Stkld1 UTSW 2 26952705 missense probably damaging 1.00
R5707:Stkld1 UTSW 2 26943987 missense probably damaging 1.00
R6259:Stkld1 UTSW 2 26949381 missense possibly damaging 0.70
R6306:Stkld1 UTSW 2 26943887 missense probably damaging 0.98
R6349:Stkld1 UTSW 2 26945860 missense probably benign 0.00
R6418:Stkld1 UTSW 2 26941081 missense possibly damaging 0.47
R6806:Stkld1 UTSW 2 26943910 missense probably benign 0.01
R7079:Stkld1 UTSW 2 26949347 missense probably benign 0.00
R7199:Stkld1 UTSW 2 26952714 missense probably damaging 0.98
R7522:Stkld1 UTSW 2 26947247 missense probably benign 0.13
R7556:Stkld1 UTSW 2 26947295 missense possibly damaging 0.74
R7813:Stkld1 UTSW 2 26945876 nonsense probably null
R8165:Stkld1 UTSW 2 26946656 missense probably benign 0.01
R8330:Stkld1 UTSW 2 26951503 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGTCTTGGTCACACAGCACAATCAC -3'
(R):5'- GGCAGCTTTTCGGTATCAGTTCCC -3'

Sequencing Primer
(F):5'- TCACCCCATGCTGGAGAC -3'
(R):5'- CCCAGAAGTGGTGGctcttag -3'
Posted On2013-11-18