Incidental Mutation 'R1065:4922502D21Rik'
List [record 1 of 36] next >> last >|
ID85961
Institutional Source Beutler Lab
Gene Symbol 4922502D21Rik
Ensembl Gene ENSMUSG00000047720
Gene NameRIKEN cDNA 4922502D21 gene
SynonymsLOC381816
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location129322164-129331796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129323050 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 155 (I155T)
Ref Sequence ENSEMBL: ENSMUSP00000062024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051283]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051283
AA Change: I155T

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000062024
Gene: ENSMUSG00000047720
AA Change: I155T

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
CLECT 71 183 1.32e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203159
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in 4922502D21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02053:4922502D21Rik APN 6 129326762 missense probably benign 0.00
IGL02298:4922502D21Rik APN 6 129331564 start codon destroyed probably benign 0.09
IGL03350:4922502D21Rik APN 6 129331023 missense probably benign 0.07
R0178:4922502D21Rik UTSW 6 129326823 missense probably benign 0.01
R0270:4922502D21Rik UTSW 6 129325608 nonsense probably null
R0414:4922502D21Rik UTSW 6 129326850 unclassified probably benign
R0648:4922502D21Rik UTSW 6 129330969 missense probably benign 0.03
R2075:4922502D21Rik UTSW 6 129326703 missense probably benign 0.01
R6163:4922502D21Rik UTSW 6 129326747 missense probably benign 0.00
R7092:4922502D21Rik UTSW 6 129323000 missense probably benign 0.12
R7107:4922502D21Rik UTSW 6 129322952 missense probably damaging 1.00
R7360:4922502D21Rik UTSW 6 129326747 missense probably benign 0.00
R7369:4922502D21Rik UTSW 6 129331533 missense possibly damaging 0.68
R7414:4922502D21Rik UTSW 6 129325633 missense probably benign 0.17
R7937:4922502D21Rik UTSW 6 129331011 missense possibly damaging 0.84
R8345:4922502D21Rik UTSW 6 129325630 missense probably damaging 1.00
R8402:4922502D21Rik UTSW 6 129323044 missense possibly damaging 0.94
X0026:4922502D21Rik UTSW 6 129326693 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ATGATGCAGCAGTACCACGCCAAG -3'
(R):5'- AGGAAACGCCAGTTATACTCTCCCC -3'

Sequencing Primer
(F):5'- ATTAGACTTAAAGTGATGTCGATGG -3'
(R):5'- GAATTTCATCCCTCTGTGAATGG -3'
Posted On2013-11-18