Incidental Mutation 'R1065:Pde6h'
ID85962
Institutional Source Beutler Lab
Gene Symbol Pde6h
Ensembl Gene ENSMUSG00000064330
Gene Namephosphodiesterase 6H, cGMP-specific, cone, gamma
SynonymsPDEgamma, A930033D18Rik
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location136923832-136968865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 136959370 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 37 (K37T)
Ref Sequence ENSEMBL: ENSMUSP00000145191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137768] [ENSMUST00000204382] [ENSMUST00000204627]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000057650
Predicted Effect probably damaging
Transcript: ENSMUST00000137768
AA Change: K37T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119246
Gene: ENSMUSG00000064330
AA Change: K37T

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 83 4.7e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000204382
AA Change: K37T
SMART Domains Protein: ENSMUSP00000145119
Gene: ENSMUSG00000064330
AA Change: K37T

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 56 1.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204627
AA Change: K37T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145191
Gene: ENSMUSG00000064330
AA Change: K37T

DomainStartEndE-ValueType
Pfam:PDE6_gamma 2 74 1.5e-41 PFAM
Meta Mutation Damage Score 0.1899 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the inhibitory (or gamma) subunit of the cone-specific cGMP phosphodiesterase, which is a tetramer composed of two catalytic chains (alpha and beta), and two inhibitory chains (gamma). It is specifically expressed in the retina, and is involved in the transmission and amplification of the visual signal. Mutations in this gene are associated with retinal cone dystrophy type 3A (RCD3A). [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous mutation of this gene does not affect the retina or photoreceptor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zfp418 C A 7: 7,181,562 Q175K probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Pde6h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02488:Pde6h APN 6 136963266 splice site probably null
IGL03121:Pde6h APN 6 136959282 missense probably null
PIT4151001:Pde6h UTSW 6 136961187 missense possibly damaging 0.48
R2001:Pde6h UTSW 6 136963205 missense probably damaging 0.99
R2852:Pde6h UTSW 6 136963208 missense probably damaging 1.00
R4052:Pde6h UTSW 6 136959268 missense unknown
R4964:Pde6h UTSW 6 136961203 missense possibly damaging 0.92
R4966:Pde6h UTSW 6 136961203 missense possibly damaging 0.92
R7335:Pde6h UTSW 6 136963213 missense probably damaging 1.00
R7629:Pde6h UTSW 6 136959319 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GCGTGTGTCAACACAAAATGCCAAG -3'
(R):5'- TCCAGGTTAAAGCACGGGTTATGTC -3'

Sequencing Primer
(F):5'- CCAAGCTTCTGAGTTAGAGTGC -3'
(R):5'- ccacacagacacaccacac -3'
Posted On2013-11-18