Mutagenetix > Incidental Mutations

Incidental Mutation 'R1065:Pde3a'

85963

Institutional Source

Beutler Lab

Gene Symbol

Pde3a

Ensembl Gene

ENSMUSG00000041741

Gene Name

phosphodiesterase 3A, cGMP inhibited

Synonyms

A930022O17Rik

MMRRC Submission

039151-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.274) question?

Stock #

R1065 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141249269-141507448 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 141476732 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000038749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043259]

Predicted Effect

probably benign
Transcript: ENSMUST00000043259

SMART Domains

Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741

Domain	Start	End	E-Value	Type
low complexity region	29	43	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	93	102	N/A	INTRINSIC
low complexity region	103	121	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
transmembrane domain	230	252	N/A	INTRINSIC
low complexity region	419	445	N/A	INTRINSIC
low complexity region	520	544	N/A	INTRINSIC
HDc	749	964	3.76e-4	SMART
low complexity region	1028	1056	N/A	INTRINSIC
low complexity region	1114	1133	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.5%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4922502D21Rik	A	G	6: 129,323,050	I155T	possibly damaging	Het
Cd300ld2	T	C	11: 115,013,760	T94A	probably damaging	Het
Cdc42bpg	G	A	19: 6,322,826	S1515N	probably damaging	Het
Ckb	T	C	12: 111,671,247	E150G	probably benign	Het
Cobl	T	A	11: 12,254,327	M785L	possibly damaging	Het
Col6a5	T	C	9: 105,881,783	N2075D	probably damaging	Het
Commd7	G	C	2: 153,619,527		probably benign	Het
Corin	G	A	5: 72,301,650	R927*	probably null	Het
Ift122	A	T	6: 115,875,325		probably null	Het
Il1b	G	A	2: 129,368,007	T83I	probably benign	Het
Ints4	T	C	7: 97,507,892		probably null	Het
Msh6	T	G	17: 87,988,463		probably benign	Het
Mtmr3	T	C	11: 4,492,859	K392E	probably damaging	Het
Olfr1094	A	G	2: 86,829,544	H264R	probably damaging	Het
Pde6h	A	C	6: 136,959,370	K37T	probably damaging	Het
Plat	C	A	8: 22,776,863	D290E	probably damaging	Het
Polk	A	C	13: 96,508,252	L122R	probably damaging	Het
Ppp1r3g	T	A	13: 35,969,435	D279E	probably benign	Het
Ptpru	T	C	4: 131,808,340	E370G	possibly damaging	Het
Ralgapa2	T	C	2: 146,450,558	Y187C	probably benign	Het
Rps6ka2	C	T	17: 7,281,758		probably benign	Het
Slit3	T	C	11: 35,121,635	S41P	possibly damaging	Het
Smarca5	A	T	8: 80,704,714	L958Q	probably damaging	Het
Snx9	T	C	17: 5,902,361		probably benign	Het
Stkld1	A	T	2: 26,940,038	N72I	probably damaging	Het
Strc	C	A	2: 121,366,651	D1532Y	probably damaging	Het
Sucla2	C	T	14: 73,560,634		probably benign	Het
Svil	T	G	18: 5,063,777		probably benign	Het
Traf3ip1	T	A	1: 91,500,784	D122E	unknown	Het
Vmn2r7	A	T	3: 64,707,138	D509E	possibly damaging	Het
Vps52	C	A	17: 33,961,239	Q306K	probably benign	Het
Wdr60	C	T	12: 116,256,076	R82H	probably damaging	Het
Zfp407	C	T	18: 84,559,773	A1072T	probably benign	Het
Zfp418	C	A	7: 7,181,562	Q175K	probably benign	Het
Zxdc	T	C	6: 90,378,903	S465P	probably damaging	Het

Other mutations in Pde3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01388:Pde3a	APN	6	141459738	missense	probably damaging	1.00
IGL01400:Pde3a	APN	6	141459228	missense	probably benign	0.02
IGL01752:Pde3a	APN	6	141487613	splice site	probably benign
IGL01819:Pde3a	APN	6	141487537	missense	probably damaging	1.00
IGL02014:Pde3a	APN	6	141459144	missense	probably null	1.00
IGL02119:Pde3a	APN	6	141459803	missense	probably damaging	0.97
IGL02465:Pde3a	APN	6	141249675	missense	possibly damaging	0.53
IGL02677:Pde3a	APN	6	141405172	splice site	probably benign
IGL02961:Pde3a	APN	6	141459700	nonsense	probably null
IGL03034:Pde3a	APN	6	141492400	splice site	probably benign
IGL03142:Pde3a	APN	6	141492299	missense	probably benign	0.01
PIT4305001:Pde3a	UTSW	6	141492310	missense	probably benign	0.04
R0412:Pde3a	UTSW	6	141498684	missense	probably damaging	1.00
R0517:Pde3a	UTSW	6	141498657	nonsense	probably null
R0573:Pde3a	UTSW	6	141492231	missense	probably damaging	1.00
R0621:Pde3a	UTSW	6	141249999	missense	probably damaging	1.00
R0781:Pde3a	UTSW	6	141459316	splice site	probably benign
R1110:Pde3a	UTSW	6	141459316	splice site	probably benign
R1462:Pde3a	UTSW	6	141459834	missense	probably benign	0.05
R1462:Pde3a	UTSW	6	141459834	missense	probably benign	0.05
R1470:Pde3a	UTSW	6	141466206	missense	probably benign	0.41
R1470:Pde3a	UTSW	6	141466206	missense	probably benign	0.41
R1480:Pde3a	UTSW	6	141487574	missense	probably benign	0.17
R1559:Pde3a	UTSW	6	141459098	missense	probably damaging	1.00
R1862:Pde3a	UTSW	6	141250353	missense	probably damaging	1.00
R1862:Pde3a	UTSW	6	141487513	missense	probably damaging	1.00
R1902:Pde3a	UTSW	6	141498770	missense	probably benign
R1909:Pde3a	UTSW	6	141250239	missense	probably benign	0.00
R2048:Pde3a	UTSW	6	141489006	splice site	probably benign
R2144:Pde3a	UTSW	6	141490111	missense	probably benign	0.40
R2155:Pde3a	UTSW	6	141483914	missense	possibly damaging	0.70
R2208:Pde3a	UTSW	6	141250347	missense	probably damaging	0.97
R2405:Pde3a	UTSW	6	141481242	missense	probably damaging	1.00
R4592:Pde3a	UTSW	6	141459216	missense	probably benign	0.13
R4677:Pde3a	UTSW	6	141466139	missense	probably benign	0.02
R4803:Pde3a	UTSW	6	141459086	missense	probably damaging	1.00
R4887:Pde3a	UTSW	6	141470942	missense	possibly damaging	0.94
R4999:Pde3a	UTSW	6	141250025	missense	probably benign	0.00
R5055:Pde3a	UTSW	6	141487956	nonsense	probably null
R5181:Pde3a	UTSW	6	141481255	critical splice donor site	probably null
R5640:Pde3a	UTSW	6	141483915	missense	probably damaging	0.99
R5694:Pde3a	UTSW	6	141250502	missense	possibly damaging	0.48
R6176:Pde3a	UTSW	6	141498889	missense	possibly damaging	0.96
R6394:Pde3a	UTSW	6	141487511	missense	probably damaging	1.00
R6692:Pde3a	UTSW	6	141479346	missense	probably damaging	1.00
R6968:Pde3a	UTSW	6	141487932	missense	probably damaging	1.00
R7137:Pde3a	UTSW	6	141498746	missense	probably benign	0.26
R7163:Pde3a	UTSW	6	141487544	missense	probably damaging	1.00
R7677:Pde3a	UTSW	6	141250257	missense	probably damaging	1.00
R7754:Pde3a	UTSW	6	141459249	missense	probably benign	0.32
X0053:Pde3a	UTSW	6	141483969	splice site	probably null
X0062:Pde3a	UTSW	6	141249984	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTAGTCCTTCCTCCCTGAGGTATACAT -3'
(R):5'- TGATCCAGGTTACAGTATCCCAAGGAAA -3'

Sequencing Primer
(F):5'- cctccctgaggtatacatcttaatg -3'
(R):5'- aacattacccaccccacac -3'

Posted On

2013-11-18