Incidental Mutation 'R1065:Zfp418'
Institutional Source Beutler Lab
Gene Symbol Zfp418
Ensembl Gene ENSMUSG00000034538
Gene Namezinc finger protein 418
MMRRC Submission 039151-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1065 (G1)
Quality Score225
Status Validated
Chromosomal Location7171330-7183562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 7181562 bp
Amino Acid Change Glutamine to Lysine at position 175 (Q175K)
Ref Sequence ENSEMBL: ENSMUSP00000057159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051435]
Predicted Effect probably benign
Transcript: ENSMUST00000051435
AA Change: Q175K

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057159
Gene: ENSMUSG00000034538
AA Change: Q175K

KRAB 25 78 2.58e-17 SMART
low complexity region 196 211 N/A INTRINSIC
ZnF_C2H2 256 278 6.32e-3 SMART
ZnF_C2H2 284 306 2.57e-3 SMART
ZnF_C2H2 312 334 1.56e-2 SMART
ZnF_C2H2 340 362 1.36e-2 SMART
ZnF_C2H2 368 390 1.82e-3 SMART
ZnF_C2H2 396 418 1.04e-3 SMART
ZnF_C2H2 424 446 2.75e-3 SMART
ZnF_C2H2 452 474 4.47e-3 SMART
ZnF_C2H2 480 502 1.58e-3 SMART
ZnF_C2H2 508 530 8.6e-5 SMART
ZnF_C2H2 536 558 7.78e-3 SMART
ZnF_C2H2 564 586 1.5e-4 SMART
ZnF_C2H2 592 614 4.54e-4 SMART
ZnF_C2H2 620 642 5.59e-4 SMART
Meta Mutation Damage Score 0.2469 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,323,050 I155T possibly damaging Het
Cd300ld2 T C 11: 115,013,760 T94A probably damaging Het
Cdc42bpg G A 19: 6,322,826 S1515N probably damaging Het
Ckb T C 12: 111,671,247 E150G probably benign Het
Cobl T A 11: 12,254,327 M785L possibly damaging Het
Col6a5 T C 9: 105,881,783 N2075D probably damaging Het
Commd7 G C 2: 153,619,527 probably benign Het
Corin G A 5: 72,301,650 R927* probably null Het
Ift122 A T 6: 115,875,325 probably null Het
Il1b G A 2: 129,368,007 T83I probably benign Het
Ints4 T C 7: 97,507,892 probably null Het
Msh6 T G 17: 87,988,463 probably benign Het
Mtmr3 T C 11: 4,492,859 K392E probably damaging Het
Olfr1094 A G 2: 86,829,544 H264R probably damaging Het
Pde3a T C 6: 141,476,732 probably benign Het
Pde6h A C 6: 136,959,370 K37T probably damaging Het
Plat C A 8: 22,776,863 D290E probably damaging Het
Polk A C 13: 96,508,252 L122R probably damaging Het
Ppp1r3g T A 13: 35,969,435 D279E probably benign Het
Ptpru T C 4: 131,808,340 E370G possibly damaging Het
Ralgapa2 T C 2: 146,450,558 Y187C probably benign Het
Rps6ka2 C T 17: 7,281,758 probably benign Het
Slit3 T C 11: 35,121,635 S41P possibly damaging Het
Smarca5 A T 8: 80,704,714 L958Q probably damaging Het
Snx9 T C 17: 5,902,361 probably benign Het
Stkld1 A T 2: 26,940,038 N72I probably damaging Het
Strc C A 2: 121,366,651 D1532Y probably damaging Het
Sucla2 C T 14: 73,560,634 probably benign Het
Svil T G 18: 5,063,777 probably benign Het
Traf3ip1 T A 1: 91,500,784 D122E unknown Het
Vmn2r7 A T 3: 64,707,138 D509E possibly damaging Het
Vps52 C A 17: 33,961,239 Q306K probably benign Het
Wdr60 C T 12: 116,256,076 R82H probably damaging Het
Zfp407 C T 18: 84,559,773 A1072T probably benign Het
Zxdc T C 6: 90,378,903 S465P probably damaging Het
Other mutations in Zfp418
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Zfp418 APN 7 7181449 missense possibly damaging 0.72
IGL02351:Zfp418 APN 7 7174691 splice site probably benign
IGL02358:Zfp418 APN 7 7174691 splice site probably benign
P0029:Zfp418 UTSW 7 7174637 missense probably damaging 0.98
R0018:Zfp418 UTSW 7 7182450 missense probably benign 0.06
R0018:Zfp418 UTSW 7 7182450 missense probably benign 0.06
R1168:Zfp418 UTSW 7 7182501 missense possibly damaging 0.91
R1660:Zfp418 UTSW 7 7181790 missense probably benign 0.04
R1937:Zfp418 UTSW 7 7182402 missense possibly damaging 0.71
R2266:Zfp418 UTSW 7 7182808 missense probably benign 0.18
R3119:Zfp418 UTSW 7 7181689 missense possibly damaging 0.53
R4355:Zfp418 UTSW 7 7172162 missense probably benign 0.02
R4539:Zfp418 UTSW 7 7181277 missense probably benign 0.18
R4735:Zfp418 UTSW 7 7182562 missense probably damaging 0.96
R4756:Zfp418 UTSW 7 7182763 missense possibly damaging 0.89
R4763:Zfp418 UTSW 7 7181445 missense possibly damaging 0.53
R4810:Zfp418 UTSW 7 7182847 missense possibly damaging 0.82
R5347:Zfp418 UTSW 7 7182535 missense probably benign 0.40
R5592:Zfp418 UTSW 7 7181315 missense possibly damaging 0.72
R5640:Zfp418 UTSW 7 7181981 nonsense probably null
R5974:Zfp418 UTSW 7 7182200 missense possibly damaging 0.95
R6209:Zfp418 UTSW 7 7182097 missense possibly damaging 0.51
R6218:Zfp418 UTSW 7 7182628 missense possibly damaging 0.73
R6502:Zfp418 UTSW 7 7182600 missense possibly damaging 0.86
R6619:Zfp418 UTSW 7 7181896 missense probably damaging 0.98
R7205:Zfp418 UTSW 7 7181563 missense probably benign 0.33
R7299:Zfp418 UTSW 7 7182828 missense possibly damaging 0.61
R7492:Zfp418 UTSW 7 7181397 missense possibly damaging 0.53
R7774:Zfp418 UTSW 7 7182777 missense possibly damaging 0.51
R7826:Zfp418 UTSW 7 7182669 missense probably benign 0.32
R7974:Zfp418 UTSW 7 7182168 missense possibly damaging 0.61
R8002:Zfp418 UTSW 7 7181874 missense probably benign 0.04
R8182:Zfp418 UTSW 7 7181659 missense probably benign 0.00
R8298:Zfp418 UTSW 7 7182815 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ctttccacattcaccacatctatac -3'
Posted On2013-11-18